ID: 1136563212

View in Genome Browser
Species Human (GRCh38)
Location 16:31053479-31053501
Sequence CTTTCTAAACTGAAAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136563212_1136563218 2 Left 1136563212 16:31053479-31053501 CCACCCTCTTTCAGTTTAGAAAG No data
Right 1136563218 16:31053504-31053526 TACCTGTATTCCTTGGCTGGTGG No data
1136563212_1136563217 -1 Left 1136563212 16:31053479-31053501 CCACCCTCTTTCAGTTTAGAAAG No data
Right 1136563217 16:31053501-31053523 GGCTACCTGTATTCCTTGGCTGG No data
1136563212_1136563216 -5 Left 1136563212 16:31053479-31053501 CCACCCTCTTTCAGTTTAGAAAG No data
Right 1136563216 16:31053497-31053519 GAAAGGCTACCTGTATTCCTTGG No data
1136563212_1136563222 18 Left 1136563212 16:31053479-31053501 CCACCCTCTTTCAGTTTAGAAAG No data
Right 1136563222 16:31053520-31053542 CTGGTGGGTCCATCCTCCATTGG No data
1136563212_1136563219 3 Left 1136563212 16:31053479-31053501 CCACCCTCTTTCAGTTTAGAAAG No data
Right 1136563219 16:31053505-31053527 ACCTGTATTCCTTGGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136563212 Original CRISPR CTTTCTAAACTGAAAGAGGG TGG (reversed) Intergenic
No off target data available for this crispr