ID: 1136564150

View in Genome Browser
Species Human (GRCh38)
Location 16:31060107-31060129
Sequence TAAACAGATGTGTTCACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 215}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136564149_1136564150 9 Left 1136564149 16:31060075-31060097 CCATAATCAAATAAGTATGGGCT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 1136564150 16:31060107-31060129 TAAACAGATGTGTTCACTGCTGG 0: 1
1: 0
2: 3
3: 29
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136564150 Original CRISPR TAAACAGATGTGTTCACTGC TGG Intergenic
901130659 1:6961027-6961049 TAAGCAGATGTTTTCACTCCAGG - Intronic
901674313 1:10874078-10874100 CAGACAAATGTGTTCCCTGCAGG + Intergenic
904948000 1:34213413-34213435 TAAACAGATTTCTTAACTGTTGG + Intronic
905179983 1:36159689-36159711 AAGGCAGATGTGTTCACTGCAGG + Intronic
905388109 1:37618287-37618309 TAAACAGATTTCTTTACTGCAGG + Intronic
909351343 1:74656608-74656630 TAAACTGAGATGTTCACTTCAGG - Intronic
912956785 1:114159584-114159606 TAAACAGATTTGTTCTCTCCAGG - Intergenic
913189996 1:116405425-116405447 GAAAGAGATGTGTTTACTTCAGG + Intronic
920865084 1:209745130-209745152 TTTACAGGTATGTTCACTGCTGG + Intergenic
922466119 1:225846415-225846437 TACAGAGATGTGTGCACAGCTGG + Exonic
922516483 1:226211941-226211963 TAAGCTCATGTGTTCACTGCTGG + Intergenic
924311240 1:242745273-242745295 TAAACAGGTGTTGTCACTGCAGG + Intergenic
1063102773 10:2964796-2964818 TAAACAGAAATGTTCACTCTGGG + Intergenic
1064066944 10:12190421-12190443 TACACAGACGTTTCCACTGCTGG - Intronic
1064608436 10:17070177-17070199 TAAAAGTATGTGTTCACTTCTGG + Intronic
1065142817 10:22735889-22735911 TATACAAAGGTGTACACTGCGGG + Intergenic
1065150347 10:22816534-22816556 TGAACAGATGTATACACTTCTGG + Intergenic
1065820863 10:29523975-29523997 GACACTGATGTGTTCACGGCAGG + Exonic
1067005770 10:42660224-42660246 TCAACAGATGTGTGCTCTGGAGG + Intergenic
1067770308 10:49117726-49117748 TTTACAGCTGTGTGCACTGCTGG + Intergenic
1068460035 10:57317182-57317204 TAAACAGATGTGTTTAAATCAGG + Intergenic
1069882185 10:71600462-71600484 TCAACAGACATCTTCACTGCTGG - Intronic
1070340103 10:75490238-75490260 TAAATAGAGGTGTTCCCTGATGG + Intronic
1071675752 10:87654593-87654615 AAAACAGAGGTGATGACTGCTGG - Intergenic
1072851990 10:98905613-98905635 TAACCAGTTGTGTTTAATGCTGG - Intronic
1074143274 10:110695640-110695662 GAAACAGATGAGTTCGCTGATGG + Intronic
1075658644 10:124177942-124177964 TAGACAGATGTGTAAACAGCAGG + Intergenic
1075840595 10:125499070-125499092 TATACAGATGTCTTCAGGGCAGG + Intergenic
1076468511 10:130702506-130702528 AAAGCAGATGTGTGCACAGCTGG + Intergenic
1076485574 10:130814153-130814175 AAAACAAATGTGGTCACTGAAGG - Intergenic
1080269989 11:30440960-30440982 TAAAGAGGTGTCTTTACTGCAGG + Intronic
1080610577 11:33900515-33900537 TAAACAGAGATGTTTACTGTGGG - Intergenic
1080779075 11:35414148-35414170 TAAACAGATATGACCACTGTTGG - Intronic
1081393580 11:42558882-42558904 TCAACATATGTGTTCACTAATGG + Intergenic
1081829043 11:46090566-46090588 TAAACAGGTTTCTTTACTGCAGG - Intronic
1082199974 11:49354497-49354519 TAAACAGATGTGTTTTCATCTGG + Intergenic
1083739215 11:64699272-64699294 TAAAGAGCTGTGTTCATCGCTGG - Intronic
1084714896 11:70867439-70867461 CAAACAGCTATGTCCACTGCTGG + Intronic
1085802219 11:79601173-79601195 AAAACAGATGGGTGTACTGCTGG + Intergenic
1086655696 11:89351700-89351722 TAAACAGATGTGTTTTCGTCTGG - Intronic
1089939605 11:122401957-122401979 TGCACACATGTGTTCATTGCAGG + Intergenic
1090247178 11:125224784-125224806 TAGACAGATGTGTACGGTGCTGG - Intronic
1090400514 11:126445627-126445649 GAGACACAGGTGTTCACTGCTGG - Intronic
1093605486 12:21083513-21083535 TAGTCACCTGTGTTCACTGCTGG + Intronic
1097470954 12:59990823-59990845 TAAAAAGACGTGTCCACGGCCGG + Intergenic
1097836492 12:64278209-64278231 TCATCAGATGTGTTTACTACAGG + Intronic
1099286681 12:80721505-80721527 GAAACCCAAGTGTTCACTGCAGG - Intergenic
1099590851 12:84587578-84587600 TAAACTGATCTGGTCACTCCTGG + Intergenic
1099764301 12:86962235-86962257 TAAACAGATTTGTAGAATGCAGG + Intergenic
1101209946 12:102525644-102525666 TAAGCAGTTATCTTCACTGCAGG + Intergenic
1103213421 12:119183140-119183162 TAAACAGGTCTTCTCACTGCAGG + Intronic
1104246154 12:127043422-127043444 CAATCAGACATGTTCACTGCGGG + Intergenic
1104656217 12:130575479-130575501 GAAAGAGATGTGTTCACTGATGG - Intronic
1105575304 13:21645509-21645531 CAAAGAGAGGTGTTCACTTCAGG + Intergenic
1106026100 13:25956914-25956936 AAAACAGATGTGTAGACTGATGG + Intronic
1106547880 13:30746060-30746082 CAAACAGAGCTGTTCACTCCCGG - Intronic
1106946727 13:34836166-34836188 TAAACAGATGTGTTGTCATCAGG - Intergenic
1107241351 13:38238683-38238705 TAAAAAGGTGAGTTCACAGCTGG + Intergenic
1109753029 13:66721392-66721414 TAAACAGATATCTTTACTGCAGG - Intronic
1110592085 13:77275034-77275056 TCAACAGATGTACTCACTGAAGG - Intronic
1111124591 13:83898000-83898022 TAAAAAGATGTCTTCAATGTAGG + Intergenic
1112138350 13:96609353-96609375 TAAAGAGAGGTTTTCTCTGCTGG + Intronic
1112393878 13:99010813-99010835 CAAACAGATGTCTTGAGTGCAGG - Intronic
1113084119 13:106549797-106549819 GAAACAGTTGTCTTCACTTCAGG - Intronic
1114301054 14:21378393-21378415 CATATAGATGTTTTCACTGCTGG - Intronic
1116668136 14:47805225-47805247 TAATCAGCATTGTTCACTGCTGG - Intergenic
1117046635 14:51819070-51819092 GACACAGATCTGCTCACTGCAGG - Intergenic
1117951863 14:61090786-61090808 TCAATAGCTGTGATCACTGCTGG - Intergenic
1117981795 14:61348969-61348991 GACACAGAAGTGTTCCCTGCTGG + Intronic
1119005050 14:70917598-70917620 TAAACAGATGTGATGTCTTCTGG + Intronic
1120047836 14:79828289-79828311 TAAAGTGATGAGTTCACTGGAGG + Intronic
1120821891 14:88919209-88919231 TAAACAGATGTCTCCACGGAAGG - Intergenic
1121103688 14:91266707-91266729 TTAAGTGATGTGTTCAGTGCTGG + Intergenic
1121366501 14:93316979-93317001 TAAACAGATTTCTTAACTACAGG - Intronic
1125236681 15:37522807-37522829 TAAACAGATGTGCTCTCATCTGG + Intergenic
1125949775 15:43742195-43742217 TCAACAGAAGTGTCCAGTGCCGG - Intergenic
1128981595 15:72191497-72191519 TAAAAAGATGTGTTCCCAGCTGG - Intronic
1129003180 15:72350806-72350828 AAAACAGATGTGATAACTTCTGG - Intronic
1129369617 15:75082204-75082226 TAAACGTATGTGTTTACTTCTGG - Intronic
1130085306 15:80773481-80773503 TAAACAGACGTGTAAACTGATGG + Intergenic
1130153924 15:81333426-81333448 TAAACAGTTTTCTTTACTGCTGG + Intronic
1130683350 15:86015354-86015376 AAGAGAGATGTGTACACTGCAGG + Intergenic
1131440774 15:92457975-92457997 TACAAAGCTGTGTGCACTGCTGG + Intronic
1131761865 15:95632358-95632380 TCAACACAAGTGTTCACTGATGG - Intergenic
1132929739 16:2452903-2452925 TAAACACATGTGGTCCATGCAGG - Intronic
1134365133 16:13570186-13570208 GAAACATATGTGTGCCCTGCTGG + Intergenic
1135428935 16:22365420-22365442 TTAACAGTTGTATTCACAGCAGG - Intronic
1135593384 16:23721717-23721739 CAAACAGATGTGTTCACTATAGG - Intergenic
1136564150 16:31060107-31060129 TAAACAGATGTGTTCACTGCTGG + Intergenic
1137366376 16:47863159-47863181 TAACCAGAGGCGTCCACTGCAGG + Intergenic
1137999041 16:53254704-53254726 TAAACACATTTGTTTTCTGCAGG + Intronic
1140667720 16:77243008-77243030 TAAACAAGTTTCTTCACTGCAGG - Intergenic
1141334180 16:83139373-83139395 GTAACAGCTGTGTTCACTGTTGG + Intronic
1142216135 16:88830995-88831017 TAAACAGGTTTCTTCCCTGCAGG - Intronic
1143310478 17:5983821-5983843 TAAAAAGATGTGTACTCGGCCGG - Intronic
1146468662 17:33107374-33107396 TAAACACATTTATTCATTGCAGG - Intronic
1149300658 17:55302236-55302258 TAAACTGATCTGTGGACTGCTGG - Intronic
1149779465 17:59385991-59386013 TAAACAGATGATTTCAATCCAGG + Intronic
1149807757 17:59635438-59635460 TAATCAGATGTGAGAACTGCTGG + Intronic
1150617442 17:66783275-66783297 TAAACAGCTTTGTTCACTGCAGG + Intronic
1153394286 18:4600533-4600555 TGAAAAGATGTCTTTACTGCAGG + Intergenic
1155932552 18:31723015-31723037 AAAAGACATGTTTTCACTGCAGG + Intergenic
1156995631 18:43463438-43463460 TAAACCTAAGTGTTCACTCCAGG + Intergenic
1157968757 18:52241200-52241222 TAAACTGAGGTGTTCTGTGCAGG + Intergenic
1159016000 18:63102033-63102055 TAAACAGATGTGGTCAAGGATGG + Intergenic
1162088962 19:8265521-8265543 GAAACAACTGTATTCACTGCTGG + Intronic
1162384019 19:10350529-10350551 TAAACTCATGTTTTCTCTGCTGG - Exonic
1163445559 19:17344178-17344200 TAAAATGATGTGTACAATGCTGG - Intergenic
1164778648 19:30874159-30874181 TAAACAGATGGGTTCCCTGAGGG + Intergenic
1164855769 19:31519539-31519561 TAAACAGATGTTTTCTGTGAAGG - Intergenic
1167626964 19:50597108-50597130 TAAACAGATGTGTTGTATTCAGG - Intergenic
926895313 2:17680750-17680772 TAAACAGATGTGCTCTCATCAGG + Intronic
927226502 2:20770702-20770724 TTAGCAGTTGTGTACACTGCAGG + Intronic
927933401 2:27060259-27060281 TAAGCAACTGTGCTCACTGCTGG - Intronic
930135135 2:47895571-47895593 TACACAGATGTGTTTACTTCAGG + Intronic
932876396 2:75456696-75456718 TAAACAGATTTGGTCACATCAGG - Intergenic
933257887 2:80101499-80101521 TAAACAAATGTATTCACTTCAGG - Intronic
934637904 2:96007890-96007912 TATTCAGAAGTGTTCACAGCAGG - Intergenic
934795750 2:97097528-97097550 TATTCAGAAGTGTTCACAGCAGG + Intergenic
935456706 2:103277699-103277721 TAACCAGATGGTTTTACTGCTGG + Intergenic
939745631 2:145962898-145962920 TTAAAAGATGTGCACACTGCTGG + Intergenic
940322236 2:152389791-152389813 AAAACAGACTTTTTCACTGCAGG + Intronic
940719532 2:157266985-157267007 CAGAGAGATTTGTTCACTGCAGG - Intronic
942639374 2:178045298-178045320 TAAACAGATTCCTTCCCTGCAGG + Intronic
944277897 2:197860324-197860346 TGCACACATGTGTTCATTGCAGG - Intronic
946058410 2:216920567-216920589 TGAACAGAGGTTTCCACTGCTGG + Intergenic
946069660 2:217022672-217022694 TGAATAGCTGTGTTCACTGAAGG + Intergenic
946466598 2:219917618-219917640 TTAACAGGTATGTTTACTGCAGG + Intergenic
947468229 2:230373508-230373530 TAAACAGATGTGCTCTCATCTGG - Intronic
1169014579 20:2281189-2281211 TAGATAGATGTCTTTACTGCAGG - Intergenic
1171042665 20:21779861-21779883 TAAACAGATTTCTTCATTTCAGG - Intergenic
1173546693 20:43903304-43903326 TTTACAGATGTGATCCCTGCTGG - Intergenic
1175568381 20:59999178-59999200 TCAACATATATGTTCACTGAGGG - Intronic
1176056026 20:63149702-63149724 GGAACAGCTGTGTGCACTGCAGG - Intergenic
1177664565 21:24137746-24137768 TCAACAGATTTGTTCAATGCAGG - Intergenic
1178736165 21:35154111-35154133 TAAACAGAGATGCTCATTGCAGG + Intronic
949988179 3:9555636-9555658 AAAACAGACGTGGTCCCTGCCGG + Intergenic
950322439 3:12069541-12069563 AAAACACATGTGTCCACGGCCGG - Intronic
950683404 3:14600909-14600931 TCAAGAGATGTGTTCAGTGTGGG + Intergenic
950952566 3:17016058-17016080 TAATCAGATATCTTTACTGCAGG + Intronic
951129267 3:19022716-19022738 CAACCAGATGTGTTCTCTGTGGG + Intergenic
951472220 3:23068849-23068871 GAAAGATATGTGTTCATTGCAGG + Intergenic
951497245 3:23343647-23343669 TACACAGATGTGTTCACTTGAGG - Intronic
953142475 3:40241586-40241608 TAAACAGATTTCTTTACTGCAGG - Intronic
953970158 3:47341135-47341157 TAAACAGAGTTATTTACTGCAGG - Intronic
958821176 3:98975604-98975626 TGGACACATATGTTCACTGCAGG + Intergenic
959967535 3:112373821-112373843 AAAATAGATGTGTTCATTGGAGG + Intergenic
960047503 3:113212051-113212073 TAAAAAGTTGTGTTTACTGTTGG + Intronic
960230948 3:115226693-115226715 TAAATAGATTTCTTGACTGCAGG - Intergenic
962402187 3:135069949-135069971 CAAACAGATGTCTTTACTGCAGG + Intronic
962742993 3:138376728-138376750 TAAACAAGTTTCTTCACTGCAGG + Intronic
963115356 3:141724400-141724422 TAAACAGATGTATCCACAGTGGG + Intergenic
965438749 3:168686568-168686590 TAAACAGATGTGTTGTCATCAGG - Intergenic
965711556 3:171560720-171560742 TAAATAAATATGTTCACTACAGG + Intergenic
966842331 3:184099871-184099893 AAAACAGGTGTGTTCTCTCCGGG + Intronic
967049282 3:185767474-185767496 TAAACAGATTTCTTTACTACAGG + Intronic
968079923 3:195838816-195838838 GAAACAGCTGTGGTCACTGCAGG - Intergenic
968949817 4:3684634-3684656 GAAACAGCTGTGGTCCCTGCAGG - Intergenic
970085452 4:12340974-12340996 TTATGAGATGTTTTCACTGCTGG - Intergenic
970479241 4:16457077-16457099 TCAACAGATTTGTTCAATGCAGG + Intergenic
971993228 4:33928935-33928957 TAAACATATTTGTTCAATGGAGG - Intergenic
975317719 4:72974041-72974063 TAAACAGATTTGTCTACTGTAGG + Intergenic
977315782 4:95445830-95445852 GAAACACAGGTGTTCAGTGCTGG + Intronic
979269544 4:118743895-118743917 TAAAAAGCTGTGTTCCCTGGTGG - Intronic
979791752 4:124792181-124792203 TAAACTCTTGTGTTCACTGTAGG - Intergenic
981731227 4:147901531-147901553 TCAACAAATTTGTTCTCTGCTGG + Intronic
983111482 4:163755525-163755547 AAGACAGTTGTCTTCACTGCTGG - Intronic
983385198 4:167052969-167052991 TGAACAGCTCTGTTCACTGAAGG + Intronic
983415839 4:167453175-167453197 TAAACAGATCTGCTCACCCCAGG - Intergenic
984490339 4:180426693-180426715 TAAACACATTTCTTTACTGCAGG + Intergenic
986138983 5:5011826-5011848 TAACCAGTTGGGTTCAATGCAGG + Intergenic
986491800 5:8299978-8300000 CAAACAGATGTGTTCAGTCTTGG - Intergenic
987137008 5:14909580-14909602 TAAAAAGACATCTTCACTGCAGG - Intergenic
987614663 5:20257678-20257700 TAAATAAATGTGTACAATGCAGG - Intronic
987727280 5:21718432-21718454 TAAAAAAATCTGTTAACTGCAGG + Intergenic
987905906 5:24076989-24077011 TAAACAGATGTGTGTTCTGCTGG + Intronic
990765440 5:59177436-59177458 TAAAAAGATGTATTAAGTGCTGG + Intronic
991637981 5:68725219-68725241 TAAACAGATTTCTTTTCTGCTGG - Intergenic
995054167 5:107741064-107741086 GAAAAAGAAGTGTTCACTGCAGG + Intergenic
995072268 5:107937975-107937997 TAATCAGATGTGGTCAGTTCAGG - Intronic
995675940 5:114662492-114662514 AAAAGAGATGTGTTCGCTGGAGG + Intergenic
996665234 5:126051083-126051105 TAAATAGATGTGTTGACTGTGGG - Intergenic
998883116 5:146664999-146665021 TAAACAGATGTGCTCTATTCAGG + Intronic
1000134373 5:158331837-158331859 TAAACATAAGTGTACATTGCTGG + Intergenic
1000947364 5:167437979-167438001 TAAAGAGATGTGTTCTCTGTTGG - Intronic
1001247447 5:170115360-170115382 CACACAGATGTGTTCACTTTAGG + Intergenic
1003093236 6:3121838-3121860 GAAACAGATGTGTTGAATACAGG - Intronic
1004702070 6:18088592-18088614 TAAACAGTTGTCTTTCCTGCAGG + Intergenic
1005688343 6:28277307-28277329 TAAACAGCATTCTTCACTGCAGG + Exonic
1005794492 6:29344262-29344284 TAAAGATGTGTGTTCACTGAGGG - Intergenic
1006928245 6:37671272-37671294 TACACAGATGTGTTTACTGCAGG - Intronic
1008005859 6:46408286-46408308 TAAACAGCTGTGATGACTGCAGG + Intronic
1008606243 6:53142435-53142457 TAAACAGATTTCTTGACTGCAGG - Intronic
1008731095 6:54483483-54483505 GGAACAGATGTTTTCACTGGAGG - Intergenic
1010103257 6:72135858-72135880 TAAACAGATGGGGTCACCGTGGG - Intronic
1013751242 6:113409035-113409057 TAAGCAGACTTGTTTACTGCAGG - Intergenic
1014608243 6:123506004-123506026 GAAACATATGAGTTTACTGCAGG - Intronic
1016009884 6:139128305-139128327 TAAACAGGTTTCTTTACTGCTGG + Intergenic
1016467351 6:144338957-144338979 TAAACATATGTATTTACTGCAGG + Intronic
1018006976 6:159631478-159631500 TGGACAGAGGTTTTCACTGCAGG + Intergenic
1018818378 6:167353078-167353100 TAAACAGATGTGCTCCCATCCGG - Intronic
1018928207 6:168221889-168221911 CAGACACATGTGTGCACTGCAGG - Intergenic
1020413426 7:7918067-7918089 GAAACAGAGTTGTTAACTGCTGG - Intronic
1021624717 7:22581678-22581700 TGTACAGATGTGCTCACTGAAGG + Intronic
1021896556 7:25241887-25241909 TAAACAGTTTTCTTCACAGCAGG - Intergenic
1023219574 7:37905416-37905438 TAGACAGATTTCTTAACTGCTGG - Intronic
1024732458 7:52268150-52268172 TAAACCGGTTTCTTCACTGCAGG - Intergenic
1025222330 7:57124300-57124322 TACACAGAAGAGTTCATTGCTGG - Intronic
1025266600 7:57464884-57464906 TACACAGAAGAGTTCATTGCTGG + Intronic
1025633111 7:63295970-63295992 TACACAGAAGAGTTCATTGCTGG - Intergenic
1025649585 7:63452213-63452235 TACACAGAAGAGTTCATTGCTGG + Intergenic
1025742993 7:64215827-64215849 TACACAGAAGAGTTCATTGCTGG + Intronic
1025748011 7:64262623-64262645 TACACAGAAGAGTTCATTGCTGG + Intronic
1025792151 7:64698992-64699014 TATACAGATGGGTTCATTTCTGG + Intronic
1026378085 7:69772223-69772245 TAACCAGTTGTGTACACTTCAGG - Intronic
1026477237 7:70747442-70747464 TAAATAGATGAGCTCTCTGCTGG - Intronic
1026557095 7:71417968-71417990 TAAACCAATGCGGTCACTGCTGG + Intronic
1028136946 7:87231953-87231975 GTAACAGATGTCTTCAGTGCAGG - Intergenic
1030476406 7:110038776-110038798 TAAAAAAATGAGTTCACTGTAGG + Intergenic
1030594279 7:111518466-111518488 AAAACAGCTGTGTTCCTTGCAGG + Intronic
1033901508 7:146147073-146147095 TAAAGAGAAGTGGTCACTTCCGG - Intronic
1034028227 7:147731423-147731445 TAAACAGATGTGCTGTCTTCCGG - Intronic
1036388238 8:8300893-8300915 TAAACAGATGTGTTGTCACCAGG + Intergenic
1037498181 8:19460999-19461021 TAAATAGCTGTGTTCACTGCTGG - Intronic
1037889910 8:22618595-22618617 TCAGCAGATGTGTTTTCTGCAGG + Exonic
1042579865 8:70264678-70264700 TGAACAAAAATGTTCACTGCCGG + Intronic
1043425718 8:80146644-80146666 TAAACAAAGATGTTCAATGCAGG + Intronic
1045109842 8:98929919-98929941 TAAACAGATGTCTTTACCGTAGG + Intronic
1046844362 8:118899519-118899541 AAAGCAGATATGTTCACTCCAGG + Intergenic
1049072390 8:140366216-140366238 TGGACAGGTGTGTTCATTGCAGG - Intronic
1050531779 9:6596931-6596953 TACACAGAAGTGTTCACAGCAGG + Intronic
1051591520 9:18780468-18780490 TAAACAGATGTATGTACTGCTGG + Intronic
1051994023 9:23192126-23192148 TAAACAGCTGTGTTTGCTTCAGG - Intergenic
1055782781 9:79837503-79837525 TGCACACATATGTTCACTGCAGG - Intergenic
1057555528 9:96084735-96084757 TTAAAAGATGTGGTCACGGCCGG + Intergenic
1058639218 9:107066882-107066904 AAAATAAATGTGTTCTCTGCAGG - Intergenic
1058652185 9:107186655-107186677 TAAATACATGGGTTCACTTCTGG - Intergenic
1203703645 Un_KI270742v1:16110-16132 TAAACAGATCTCTTCTCAGCAGG - Intergenic
1186182905 X:6990324-6990346 TAGACAGATGTGTTCAATGGAGG - Intergenic
1186574990 X:10755724-10755746 TAAAGAGATGTGCTCACAACAGG - Intronic
1187515480 X:19966018-19966040 TAAACAGATCTTTTCACTTGAGG + Intronic
1188695541 X:33185910-33185932 TAAACAGCTGTCTTTCCTGCAGG + Intronic
1191154950 X:57264726-57264748 TGCACACATGTGTTCATTGCAGG + Intergenic
1194382847 X:93216658-93216680 TAAACAGGTATATGCACTGCAGG + Intergenic
1195164152 X:102201475-102201497 TAAACATATGTTTTCAGTTCTGG + Intergenic
1195194708 X:102485620-102485642 TAAACATATGTTTTCAGTTCTGG - Intergenic
1196885670 X:120243196-120243218 TAATCACATATGTTCACAGCTGG - Intergenic
1199204647 X:145134698-145134720 CAAATAAAAGTGTTCACTGCAGG + Intergenic