ID: 1136564201

View in Genome Browser
Species Human (GRCh38)
Location 16:31060491-31060513
Sequence ATGAACAATACCCCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136564197_1136564201 24 Left 1136564197 16:31060444-31060466 CCAGGCAATTGAAGACGTATATT 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1136564201 16:31060491-31060513 ATGAACAATACCCCTTTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1136564196_1136564201 27 Left 1136564196 16:31060441-31060463 CCACCAGGCAATTGAAGACGTAT 0: 1
1: 0
2: 0
3: 1
4: 60
Right 1136564201 16:31060491-31060513 ATGAACAATACCCCTTTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 117
1136564195_1136564201 30 Left 1136564195 16:31060438-31060460 CCACCACCAGGCAATTGAAGACG 0: 1
1: 0
2: 0
3: 2
4: 73
Right 1136564201 16:31060491-31060513 ATGAACAATACCCCTTTTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136564201 Original CRISPR ATGAACAATACCCCTTTTGT GGG Intergenic
901163372 1:7197719-7197741 ATGAAAAATACCCCAGTTGTTGG - Intronic
902266854 1:15273256-15273278 TTAAACAATGCCCCTTTTGATGG - Intronic
907593178 1:55695269-55695291 ATGAATCATTCCACTTTTGTGGG + Intergenic
908493135 1:64666561-64666583 ATTAACAATCCTCCTTTTCTTGG - Intronic
910455706 1:87395344-87395366 CTGAACAACACCCCCTTGGTTGG - Intergenic
911860629 1:102943380-102943402 ATAAACAAGTTCCCTTTTGTGGG - Intronic
912053057 1:105555701-105555723 ATGAACATTTCCCCTTTACTTGG + Intergenic
917856254 1:179102534-179102556 ATGACCAATCCTCTTTTTGTAGG - Exonic
918828759 1:189363882-189363904 ATGAATACTATCCCTTTTCTAGG - Intergenic
922897687 1:229113203-229113225 TTGAACAATATCACCTTTGTGGG - Intergenic
1064626665 10:17268095-17268117 ATGAAATAGAACCCTTTTGTAGG + Intergenic
1065005687 10:21377991-21378013 CTTAACCATTCCCCTTTTGTTGG - Intergenic
1066475425 10:35742340-35742362 GAGAATAATATCCCTTTTGTAGG + Intergenic
1071004720 10:80869650-80869672 CTGAAAAATTCCCATTTTGTGGG + Intergenic
1071487070 10:86109387-86109409 ATTAACAAGGCCCCTTGTGTTGG - Intronic
1072575155 10:96692714-96692736 CTGAGCTATACCCCTTTTATAGG - Intronic
1072614354 10:97039583-97039605 GATAACAAAACCCCTTTTGTTGG - Intronic
1075357824 10:121798479-121798501 TTGAACAATGCCACTTTGGTGGG + Intronic
1076037672 10:127214535-127214557 CTGAATAATACTCCTGTTGTAGG + Intronic
1079398237 11:20084473-20084495 ATGATCAATTCCTCTTTTCTTGG + Intronic
1079451272 11:20601552-20601574 CGGAACAATACCCCTGTTGTGGG + Exonic
1086059562 11:82686437-82686459 TTTAACAATTCCCCTATTGTTGG - Intergenic
1086229330 11:84549466-84549488 ATGAACATTTCCTCTTTTCTGGG - Intronic
1086665611 11:89477724-89477746 ATGAAAAAGACCCATTTTATAGG - Intronic
1086865420 11:91973830-91973852 ATGAATAAAACCCATTTTGCTGG - Intergenic
1087728155 11:101746842-101746864 TTGATCATTATCCCTTTTGTTGG + Intronic
1090288098 11:125517482-125517504 GTTAACAAGACCCCTTTTGCAGG - Intergenic
1091901492 12:4147613-4147635 AGGAACAATAACCTTTGTGTAGG - Intergenic
1093723972 12:22481465-22481487 ATGATCAATACACTTTTTGCAGG + Intronic
1094259402 12:28476031-28476053 ATGAACTATACTCCTTGTATTGG - Intronic
1097426124 12:59446589-59446611 ATGAACAATTCCCCTTCAGCTGG + Intergenic
1099341957 12:81448698-81448720 AAGTACAAAACCCCTGTTGTGGG - Intronic
1100224140 12:92539399-92539421 ATTAAAAATACCCATTGTGTGGG - Intergenic
1103284705 12:119791018-119791040 ATGAATAATACCCATCTTATAGG - Intronic
1104331636 12:127852505-127852527 AAGAACCATCCCCCTGTTGTGGG + Intergenic
1110462551 13:75761268-75761290 ATTAACACTACCATTTTTGTCGG - Intronic
1112373828 13:98820378-98820400 ATGAACAGGCCCCCTTTTGGTGG - Intronic
1113224010 13:108139496-108139518 ATGAACCATAATCCTTTTGAGGG - Intergenic
1115005754 14:28482330-28482352 ATGAACAAGAGCCAGTTTGTTGG - Intergenic
1120023291 14:79554061-79554083 ATGTAAAATACCAATTTTGTTGG + Intronic
1120102457 14:80461070-80461092 GTGAACAATACCCACCTTGTAGG - Intergenic
1120155294 14:81086597-81086619 ATTAACAACACCTCTTTTGTGGG - Intronic
1120909836 14:89656309-89656331 AAGGACACTACCCCTTTTGGGGG - Intergenic
1121127252 14:91416408-91416430 ATGAAAAAGTCCCCTTTTGGAGG - Intronic
1125743685 15:41984840-41984862 ATGGACAAAAGCCCTTTCGTTGG + Intronic
1130288182 15:82572515-82572537 ATGACTAATACCCATCTTGTTGG - Intronic
1134169330 16:11956098-11956120 ATGAACAAGACCCATGTTGATGG + Intronic
1136564201 16:31060491-31060513 ATGAACAATACCCCTTTTGTGGG + Intergenic
1138933383 16:61689318-61689340 AACAATAATACCTCTTTTGTAGG + Intronic
1139239831 16:65379492-65379514 ATAAACATTTCCCCTTTTGAAGG - Intergenic
1141840243 16:86569083-86569105 AAGATCAATACTCATTTTGTTGG - Exonic
1148020991 17:44553547-44553569 AAAAACAATACCCACTTTGTAGG + Intergenic
1155610040 18:27656453-27656475 CTGAACAATAACACTTTTGTAGG - Intergenic
1158399199 18:57105521-57105543 CCTAACAATACCCCTTGTGTAGG + Intergenic
1158998991 18:62953546-62953568 ATAAACAATACACCTTTAGCTGG - Intronic
925994206 2:9278743-9278765 AGGAACAATACCCACTTTGCAGG - Intronic
928405755 2:31013444-31013466 CTGAACATTTCCCCTTCTGTAGG - Intronic
928568756 2:32581773-32581795 ATAAACAATCCTCCTTTTGATGG - Intronic
929029596 2:37638001-37638023 ATGAACAATACTCCTGTGGCTGG - Intergenic
929349185 2:40927853-40927875 TTTAACTGTACCCCTTTTGTGGG + Intergenic
931445263 2:62321808-62321830 ATGAAAAATAACCCTATGGTGGG - Intergenic
933217091 2:79643267-79643289 AAGAACAATACCTCTTTATTTGG - Intronic
935709518 2:105885042-105885064 ATGAACAGTAACCCTTTACTGGG + Intronic
937344684 2:121117855-121117877 ATGAAAAATACTGCTATTGTGGG + Intergenic
941677143 2:168355912-168355934 AGGAACAAAAGCCATTTTGTAGG - Intergenic
946972491 2:225110428-225110450 AAGAACAATATCACTTTTTTTGG + Intergenic
1175157335 20:56980077-56980099 ATAATCGATATCCCTTTTGTGGG - Intergenic
1178098644 21:29241913-29241935 ATACACACTACTCCTTTTGTTGG - Intronic
1183116625 22:35697383-35697405 AAGAACAATATCCCTGATGTTGG + Intergenic
949727835 3:7071090-7071112 GTGAACAAAACTCCTTTAGTAGG + Intronic
951360821 3:21722312-21722334 GTGAACAATAGACATTTTGTAGG + Intronic
951733439 3:25836492-25836514 ATGAACAAAACTGCCTTTGTGGG + Intergenic
953420735 3:42751448-42751470 ATGAACACTTTCCCTTTCGTGGG - Intronic
955109379 3:55932883-55932905 ATTAACAATACCATTTTTGCTGG - Intronic
957989009 3:87607526-87607548 ATGAACAAAACCCATTTGTTTGG + Intergenic
959240935 3:103792650-103792672 ATTAACAATATCCTTTTTCTGGG + Intergenic
960193937 3:114741981-114742003 ATGAACAATTTTCCTTTTCTAGG + Intronic
961973795 3:131000596-131000618 ATGAAATAAACTCCTTTTGTTGG + Intronic
964229773 3:154452212-154452234 ATGAAAAATATTCCTTTTGAAGG + Intergenic
965963918 3:174463512-174463534 ATGAAGAATACCTGATTTGTAGG + Intronic
969263961 4:6052344-6052366 ATGAACAAAAGTCATTTTGTAGG + Intronic
973711341 4:53632934-53632956 ATGTACAAGAATCCTTTTGTAGG + Intronic
974194470 4:58554103-58554125 AATAACAATACCCCATTTGTGGG - Intergenic
979123147 4:116928227-116928249 ATGACCAATACACATTTTATTGG - Intergenic
983263407 4:165482068-165482090 ATGAGGAATACTGCTTTTGTAGG + Intronic
984690797 4:182723645-182723667 TTAAACAATACACATTTTGTTGG - Intronic
987327498 5:16825660-16825682 ATGTATAATACCCATTTTGAGGG - Intronic
987807582 5:22790174-22790196 ATGAACAAAACGTGTTTTGTTGG + Intronic
989503027 5:42191519-42191541 ATGAACATTTTCCCTTTTGTTGG + Intergenic
990238747 5:53796109-53796131 ATGATCAACGTCCCTTTTGTTGG + Intergenic
991137442 5:63198670-63198692 ATGAATAGTAGCCCTTGTGTAGG - Intergenic
992182064 5:74207222-74207244 ATGTACAATAACACTTTTTTTGG + Intergenic
992766117 5:80002193-80002215 AAGAACAAAACGCCTGTTGTAGG - Intronic
994752367 5:103753867-103753889 AATAACAATTCCTCTTTTGTAGG + Intergenic
995012444 5:107272884-107272906 ATGAACAAACGCCCCTTTGTGGG + Intergenic
996453427 5:123654279-123654301 AAGAAAAAAACCCCTTTTGTGGG + Intergenic
997778709 5:136635498-136635520 ATTAATAATACTCCTTTTGAAGG - Intergenic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003340469 6:5215131-5215153 ATTTACAATCCCCCTTTTCTAGG + Intronic
1004925871 6:20414627-20414649 ATTTGCAACACCCCTTTTGTTGG + Intronic
1007138826 6:39550555-39550577 ATGAAAAATACCCCAGTTGGTGG + Intronic
1008837137 6:55847563-55847585 ATGAATAATAGCACTTTTTTTGG - Intronic
1009640864 6:66333992-66334014 ATTAACAATAAAGCTTTTGTAGG - Intergenic
1013336065 6:109163718-109163740 AAAAAAAATACCACTTTTGTGGG - Exonic
1014117403 6:117681088-117681110 ATGAACAATAGCCTCTTGGTAGG - Intronic
1014516195 6:122381535-122381557 ATGAACAATTCTCCTGTTGGGGG + Intergenic
1021954977 7:25815286-25815308 ATGAAGAATTCCTCTTTAGTAGG + Intergenic
1023716151 7:43046421-43046443 ATGGACTATTCCCCTTTGGTTGG - Intergenic
1033134169 7:138771032-138771054 GTGAACAATAACCATTTTGTAGG - Intronic
1040695804 8:49996711-49996733 TAGAACAATAACCCTTTTGATGG - Intronic
1041132583 8:54717320-54717342 ATCAACAATACTCATTGTGTTGG - Intergenic
1043071949 8:75648143-75648165 ATGATCCTTGCCCCTTTTGTCGG - Intergenic
1043102892 8:76068865-76068887 ATGATAAATAGCCATTTTGTGGG - Intergenic
1048793767 8:138129420-138129442 CAGAACCATACCCCTTCTGTGGG + Intergenic
1048949822 8:139486922-139486944 ATGAATAATGACCCTTTTATGGG - Intergenic
1053370760 9:37559866-37559888 ATGAAAAATACACCTTTGTTTGG + Intronic
1055761132 9:79609634-79609656 ATGAACAATTGTCCTTTTATTGG + Intronic
1055854784 9:80672683-80672705 ATGAGCAATATCCCTTTAGGTGG + Intergenic
1186306203 X:8261484-8261506 TTGAAGAATAATCCTTTTGTTGG - Intergenic
1186393583 X:9185320-9185342 ATGAACAAAACCTCTTTTCCTGG + Intergenic
1186853740 X:13605771-13605793 AGGAACAACACACCTATTGTTGG + Intronic
1191067221 X:56362264-56362286 ATGAATAATACCACTTTTTGAGG - Intergenic
1194589348 X:95778867-95778889 ATTAACAATATTCCTTTTATAGG + Intergenic
1194979478 X:100425643-100425665 AAGAACAACAACCCTTTTGTGGG - Intergenic
1196230300 X:113213438-113213460 ATGAAAAATATTGCTTTTGTTGG + Intergenic
1199166388 X:144680158-144680180 ATGAAGAATAACCCCTTTTTGGG + Intergenic
1200084410 X:153596395-153596417 ATGCAGACTTCCCCTTTTGTAGG + Intronic