ID: 1136566630

View in Genome Browser
Species Human (GRCh38)
Location 16:31074363-31074385
Sequence CTCCCGAAGCGGAAGTTTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 16}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136566622_1136566630 27 Left 1136566622 16:31074313-31074335 CCGGAAGTGTGTCTGCGTAAAAC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1136566630 16:31074363-31074385 CTCCCGAAGCGGAAGTTTCGCGG 0: 1
1: 0
2: 0
3: 2
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136566630 Original CRISPR CTCCCGAAGCGGAAGTTTCG CGG Intergenic
901078228 1:6569006-6569028 CTCCCGGAGCGGAAGTGAGGAGG + Intronic
908132127 1:61083606-61083628 CTCCCGGAGTGAAAGTTTCGGGG + Intronic
910884173 1:91948683-91948705 TTCCTGAAGCGGAAGTCTGGGGG - Intergenic
911289338 1:96037976-96037998 CTCCTGAAGCTGAAGTTCCATGG - Intergenic
920206053 1:204292861-204292883 CTCCCAAGGCGGAAGTCTGGAGG + Intronic
1064588801 10:16866828-16866850 CTCCAGCAGCAGAAGTTCCGAGG + Intronic
1087468392 11:98540104-98540126 CTCCCCAAGGGGAAATATCGTGG + Intergenic
1136566630 16:31074363-31074385 CTCCCGAAGCGGAAGTTTCGCGG + Intergenic
1138224939 16:55285075-55285097 CTCCAAAACCTGAAGTTTCGTGG + Intergenic
1150207272 17:63418601-63418623 CTCCCGAAGTGAAACATTCGTGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
931517366 2:63057986-63058008 CTCCCTAAGCGAAAGTTTCTGGG - Intergenic
940375296 2:152951126-152951148 CTCCTGAAGCTCAAGTTTAGTGG - Intergenic
1173315796 20:41941995-41942017 CTACTGAATCGGAAGTTTTGAGG - Intergenic
1184759670 22:46537347-46537369 CTCTCGAAGTGGAAGCTGCGGGG - Intergenic
996443403 5:123516153-123516175 CTTCAGAAGCGGTAGTTTTGAGG + Intronic
1014434242 6:121403665-121403687 CTCATGAAGCTGAAGTTTCAGGG + Intergenic
1023958586 7:44908021-44908043 CTCCCAAATCTGAAGTTTTGGGG - Intergenic
1199987110 X:152960521-152960543 CTCCCAAAGTGGTAGTTTCCTGG + Intronic