ID: 1136573272

View in Genome Browser
Species Human (GRCh38)
Location 16:31109101-31109123
Sequence GGGGCTCTTCTCCGACTTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136573272_1136573288 18 Left 1136573272 16:31109101-31109123 CCCTGAAGTCGGAGAAGAGCCCC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136573288 16:31109142-31109164 TGCCCCATTTTGGGTCGCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 79
1136573272_1136573281 8 Left 1136573272 16:31109101-31109123 CCCTGAAGTCGGAGAAGAGCCCC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136573281 16:31109132-31109154 CACACCCCCTTGCCCCATTTTGG 0: 1
1: 0
2: 1
3: 13
4: 144
1136573272_1136573282 9 Left 1136573272 16:31109101-31109123 CCCTGAAGTCGGAGAAGAGCCCC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136573282 16:31109133-31109155 ACACCCCCTTGCCCCATTTTGGG 0: 1
1: 0
2: 0
3: 14
4: 113
1136573272_1136573287 17 Left 1136573272 16:31109101-31109123 CCCTGAAGTCGGAGAAGAGCCCC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1136573287 16:31109141-31109163 TTGCCCCATTTTGGGTCGCCTGG 0: 1
1: 0
2: 1
3: 10
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136573272 Original CRISPR GGGGCTCTTCTCCGACTTCA GGG (reversed) Exonic
900512960 1:3069019-3069041 GGGGCTCTCCTCGGCCTTCTCGG - Intergenic
900568657 1:3347659-3347681 TTGGCTCTTCTCAGACTTCTGGG + Intronic
902920878 1:19665395-19665417 GGGGCTCTGCTCCCACCCCAGGG + Exonic
904684871 1:32252565-32252587 GTGGCTCTCCTCGCACTTCAGGG + Intronic
904814899 1:33188517-33188539 GTGACTCTTCTATGACTTCATGG - Intergenic
908528496 1:65010883-65010905 GAAGCTATTCTCCCACTTCAAGG + Intergenic
909095689 1:71285360-71285382 GAGGCTCTCCTCCAAGTTCAAGG + Intergenic
909509135 1:76431322-76431344 GGAGCTCTTCACCCACTTTAGGG - Intronic
910657072 1:89630699-89630721 AGGCTTATTCTCCGACTTCAGGG - Intergenic
917346504 1:174033703-174033725 GGGTCTCTTCTCCCACTATAAGG + Intergenic
917611595 1:176694143-176694165 GGGGCTCTTCTCTGACATAAGGG - Intronic
917916142 1:179704101-179704123 GAGGCTCACCTCTGACTTCATGG + Intergenic
918078643 1:181189642-181189664 GAGGCGCTTCTCCAACGTCAGGG + Intergenic
918393653 1:184092374-184092396 GGGACTGTTCTCTGCCTTCAAGG + Intergenic
920013566 1:202887938-202887960 GGGGTTCTTTTAAGACTTCAAGG - Intronic
922211024 1:223486991-223487013 GGGGCTCTTCTCCCTCTGCTCGG - Intergenic
922893708 1:229082974-229082996 GGGGAACTTCCTCGACTTCATGG - Intergenic
924465022 1:244291813-244291835 AGGGCGCTTCTCCAACTCCATGG + Intergenic
1064472603 10:15652357-15652379 GGGGCTCTTCCCCTGCTGCACGG - Intronic
1065218365 10:23472300-23472322 GGGGCTCTTCGCTCACTTGAGGG - Intergenic
1072717504 10:97761461-97761483 GGGACTCTGCTCCTACTTCAGGG - Intergenic
1073181068 10:101583546-101583568 GGAGCTCTTCTCCAACATCTGGG - Exonic
1074154814 10:110788731-110788753 GGGACTCTTCTGCTACTTAAAGG - Intronic
1089670756 11:120055369-120055391 GGGGCTCATCTCAGATTTCTTGG + Intergenic
1091767805 12:3133239-3133261 GGTCCTCTCCTCCCACTTCAGGG + Intronic
1094221237 12:27995862-27995884 GAGGCTTTTCTCCTAGTTCATGG + Intergenic
1098385003 12:69909297-69909319 GGGGCTCTACTGCCACCTCAGGG + Intronic
1098547959 12:71731912-71731934 CTGGCTCTTTTCCGACTTCCTGG - Intergenic
1100131079 12:91494378-91494400 GGGCCTTTTGTCAGACTTCAGGG - Intergenic
1101966630 12:109286647-109286669 GGAGCACTTCCCCTACTTCAAGG - Exonic
1102389182 12:112535732-112535754 GGCTCTCTTCTCCCACTACAAGG - Intergenic
1104898645 12:132176222-132176244 GAGGCTCTTCCCCGACGCCACGG + Intergenic
1105612479 13:21981147-21981169 GGGTCTCTTCTACCACTTCAGGG - Intergenic
1107163613 13:37260276-37260298 TGAGCTCTTCTCTGTCTTCAGGG - Intergenic
1114449092 14:22813140-22813162 GGGCCTCTTCTCCGTCTTTGGGG - Exonic
1126466073 15:48962776-48962798 GGGGCTCTCCTGCGACGGCAAGG + Exonic
1127810820 15:62563893-62563915 GGGTCTCTTCTCCCACTGGATGG + Intronic
1130407443 15:83614444-83614466 GGAGCTCTTCTTCCTCTTCAGGG - Intronic
1132438327 15:101831878-101831900 GGGGTTCTTCTACAAGTTCATGG + Intergenic
1132519457 16:380818-380840 GGTGCTGTTCCCCGACTTCCCGG - Intronic
1133004149 16:2868465-2868487 GGGTCTCTTCTCCGCCCACAAGG - Intergenic
1136573272 16:31109101-31109123 GGGGCTCTTCTCCGACTTCAGGG - Exonic
1137923368 16:52514661-52514683 GGGGCTCTGCTCTTCCTTCAAGG - Intronic
1142231542 16:88902442-88902464 GTGGAGCTTCTCAGACTTCAGGG - Intronic
1142237267 16:88928128-88928150 GGGGCTCTGTTCCGACTCCTTGG + Intronic
1147110327 17:38257003-38257025 GGGCCTCTTCTCCGGCATCGCGG + Intergenic
1148419183 17:47531428-47531450 GGGCCTCTTCTCCGGCATCGCGG - Exonic
1150300521 17:64043806-64043828 GGGCCACTTCTCCCACTTCCTGG + Exonic
1150652082 17:67016794-67016816 GTGGCCATTCTCAGACTTCAGGG + Intronic
1151414595 17:73952956-73952978 GGGGCTCCTCTCCCGCTGCAAGG + Intergenic
1157430306 18:47619358-47619380 GGGGCTCATCTGGGACTTGAGGG - Intergenic
1157891824 18:51425457-51425479 GGGGCTCGCCTCCCAGTTCAGGG - Intergenic
1159483754 18:69026617-69026639 TGGGCTTTTCTCTGACTTCAGGG - Intronic
1160144133 18:76350170-76350192 GGGGCTCTTCTCACACTGAAGGG + Intergenic
1160906254 19:1453051-1453073 GTGGCTGTTCTCAGCCTTCAAGG - Exonic
1161840627 19:6678165-6678187 GGGTCTCTCCTCCGATTTCTGGG - Exonic
1163394285 19:17050094-17050116 GGGTCTCTTCCCAGACTTCCTGG + Exonic
1163798197 19:19349191-19349213 TGGGCTCTTCTCCTTCTTCCAGG + Exonic
1166147240 19:40846083-40846105 GGGGTTCTTCTCCTCCTGCAGGG + Exonic
1166151392 19:40877979-40878001 GGGGTTCTTCTCCTCCTGCAGGG + Exonic
1166155885 19:40910673-40910695 GGGGTTCTTCTCCTCCTGCAGGG + Intergenic
1166178922 19:41093622-41093644 GGGGTTCTTCTCCTCCTGCAGGG - Exonic
1166861801 19:45815653-45815675 GGGGCTCCGCTCCTCCTTCAAGG + Exonic
938580615 2:132643053-132643075 GGGACTTTTCTCCCACTTCGAGG - Intronic
940420827 2:153478036-153478058 GGCGCTCTCCTCCGACTGCCAGG + Exonic
944168731 2:196751213-196751235 TTGACTCTTCTCCGCCTTCAGGG + Intronic
944218480 2:197278905-197278927 GGGATTCTTCTCTGACTTCTTGG - Intronic
946480471 2:220051231-220051253 GGGGCCCTTCTCCCTCTTTATGG - Intergenic
946991151 2:225331095-225331117 GGAGCTTTTCTACAACTTCAAGG - Intergenic
1169854648 20:10089820-10089842 GAGACCCTTCTCCCACTTCAAGG + Intergenic
1171373447 20:24676175-24676197 GGGGCTCTTCTCCTGTGTCAAGG + Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1176892574 21:14336072-14336094 GGGACTCATATCCCACTTCATGG - Intergenic
949238153 3:1836185-1836207 GAGGCTGTTCTCCAACTTCTGGG + Intergenic
950131785 3:10552281-10552303 GGGGCCCTTCTCCTCCTGCAAGG + Intronic
951013792 3:17706184-17706206 GGGCCTCTTCTCCGGCATCGCGG + Intronic
951168070 3:19506575-19506597 TGGGCTCCTCTCCCACTTGAGGG + Intronic
962502252 3:136007414-136007436 GGTGCCCTTCTCAGACTTCAGGG + Intronic
967841629 3:194009565-194009587 AGGGCTCTTCTTCTACTTCTGGG + Intergenic
968490608 4:888881-888903 GCGGCTCTTCACCAACCTCAAGG - Exonic
969954152 4:10871039-10871061 AGGGCTCTTCTCCAGCATCACGG - Intergenic
974533774 4:63147787-63147809 GGGGCTCTTCTGATACATCATGG + Intergenic
976667562 4:87613104-87613126 GGGGATCTTCTTTGCCTTCAGGG - Exonic
985975615 5:3417338-3417360 CAGGCTCTTCTCTGAATTCAGGG + Intergenic
989229130 5:39066441-39066463 AGGCCTTTTCTCCAACTTCACGG + Intronic
1002294706 5:178223944-178223966 GGGGCTGCTCTCTGACTCCAGGG - Intronic
1002429201 5:179193240-179193262 GGGGCTCTTCCCAGACATCATGG + Intronic
1002719133 5:181247172-181247194 GGGCCTCTTCTCCAGCCTCACGG + Intronic
1015152787 6:130057289-130057311 CTGGCTCTTCTCTGACTTCCAGG - Intronic
1015694017 6:135959233-135959255 GGTGCTATTCACCAACTTCATGG - Intronic
1017919099 6:158855984-158856006 GGCTCTCTTCTCCCTCTTCATGG + Intergenic
1019750949 7:2729385-2729407 GTGGCTCTTCACAGACCTCACGG - Exonic
1029732856 7:102449112-102449134 GGGGCTCTTCTCCGGCCCCCGGG - Exonic
1035281529 7:157781482-157781504 GGGTCTGCTCTCAGACTTCAAGG + Intronic
1035327531 7:158074653-158074675 GGGGCTCTTCTCCCTGATCAGGG + Intronic
1035899808 8:3447676-3447698 AGGGCTCTGCTCCCACTTCCTGG + Intronic
1037766963 8:21778045-21778067 GGGGCTGTGCTCCGCCTTCCTGG - Intronic
1039266264 8:35827269-35827291 GGGGCTCTTCTCCTAATACCTGG - Intergenic
1039602556 8:38852795-38852817 GGGGCTCCTCACACACTTCATGG - Exonic
1043407634 8:79954498-79954520 GGGGCTTTTCTCTGCCTTCTGGG + Intronic
1045870877 8:106925550-106925572 GTGGCTATTCTCAGATTTCAAGG - Intergenic
1047208729 8:122823455-122823477 AGGTCTCTGCTTCGACTTCAGGG - Intronic
1047765627 8:127987719-127987741 TGGGCTCTTCTCAGGCTTCCTGG - Intergenic
1049779544 8:144422527-144422549 GGGGCTCTTCTCTGGCTCCTTGG + Intergenic
1055171784 9:73267209-73267231 GGGGCTCTTCTCCCCTTTCCTGG + Intergenic
1055373267 9:75623745-75623767 TGGGCTCCTCTCCCACTTGAGGG + Intergenic
1056933786 9:90900109-90900131 TGTGTTCTTCTCTGACTTCAGGG - Intergenic
1057637931 9:96788097-96788119 TGGGCTCAACTCCGAATTCAAGG - Intergenic
1061997980 9:134197430-134197452 GGGGGTCTTCGACAACTTCATGG + Intergenic
1189268988 X:39737160-39737182 GGGGCGCTTTTCCTACTTCAAGG - Intergenic
1190160885 X:48030609-48030631 GGGGAGCTTCTCCCACTGCACGG - Intronic
1196085815 X:111681464-111681486 GGGGCCCTTCTCCGGCTACCCGG + Intronic