ID: 1136573865

View in Genome Browser
Species Human (GRCh38)
Location 16:31111981-31112003
Sequence GGCCATCTGGACATGCATAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136573856_1136573865 -2 Left 1136573856 16:31111960-31111982 CCCCGGATCAGCCCCCTCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1136573865 16:31111981-31112003 GGCCATCTGGACATGCATAGTGG 0: 1
1: 0
2: 0
3: 10
4: 109
1136573854_1136573865 12 Left 1136573854 16:31111946-31111968 CCAGCACACAGGACCCCCGGATC 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1136573865 16:31111981-31112003 GGCCATCTGGACATGCATAGTGG 0: 1
1: 0
2: 0
3: 10
4: 109
1136573858_1136573865 -3 Left 1136573858 16:31111961-31111983 CCCGGATCAGCCCCCTCTTTGGC 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1136573865 16:31111981-31112003 GGCCATCTGGACATGCATAGTGG 0: 1
1: 0
2: 0
3: 10
4: 109
1136573855_1136573865 -1 Left 1136573855 16:31111959-31111981 CCCCCGGATCAGCCCCCTCTTTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1136573865 16:31111981-31112003 GGCCATCTGGACATGCATAGTGG 0: 1
1: 0
2: 0
3: 10
4: 109
1136573859_1136573865 -4 Left 1136573859 16:31111962-31111984 CCGGATCAGCCCCCTCTTTGGCC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1136573865 16:31111981-31112003 GGCCATCTGGACATGCATAGTGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136573865 Original CRISPR GGCCATCTGGACATGCATAG TGG Exonic
900265581 1:1755605-1755627 GGCCATGTGGACAAGCGGAGGGG + Intronic
901382950 1:8887214-8887236 GGCCATCTGCACTTGCACACTGG - Intergenic
904320831 1:29697007-29697029 GGTGATCTGGACATGGACAGCGG - Intergenic
910289337 1:85584893-85584915 AGCCTTATGGAAATGCATAGAGG + Intergenic
911163580 1:94705913-94705935 GGCCATGTGGTCAGGCACAGTGG - Intergenic
915951649 1:160193290-160193312 GGGATTCTGGACATGCATGGGGG + Intronic
917540474 1:175908128-175908150 TGCCATTTGGACATTTATAGAGG - Intergenic
918113502 1:181478450-181478472 GACCATGTGCAAATGCATAGTGG - Intronic
920721478 1:208391211-208391233 GGAAATCTGGAAATGCTTAGTGG - Intergenic
1063913419 10:10855195-10855217 GGACATCTTGAAATGCAGAGGGG - Intergenic
1064876313 10:19998468-19998490 GGCTACCTGGTCGTGCATAGAGG - Intronic
1068692624 10:59932510-59932532 GGCCATCTGGCCGGGCACAGTGG - Intergenic
1070373639 10:75808793-75808815 GACCATCAGGCCAGGCATAGTGG - Intronic
1076666653 10:132096988-132097010 GGCCATCTGCACATCCATGTCGG - Intergenic
1077033644 11:482599-482621 GTCCATCTGGCCAGGCACAGTGG - Intronic
1077086873 11:757262-757284 GGCCATCTGGACATGGGTGCAGG - Intronic
1077139528 11:1017881-1017903 GGCCATCTGTGCATGGGTAGGGG + Exonic
1081579203 11:44340412-44340434 GGCCCTCTGCACATGGATGGGGG + Intergenic
1084784871 11:71436375-71436397 GGCCTTCTGGCCATGCACAGTGG + Intronic
1088879551 11:113962845-113962867 TGCCAAGTGGACATGCAGAGCGG + Intergenic
1089755048 11:120680368-120680390 GGCCATCGGGCCAGGCACAGTGG - Intronic
1090043004 11:123307058-123307080 GACCATCTGGAGAAGCATAATGG + Intergenic
1090520157 11:127470563-127470585 GGCCATTTGGACTCACATAGAGG + Intergenic
1091110607 11:132962970-132962992 GGCCTGCTTGACACGCATAGAGG + Intronic
1092288335 12:7142963-7142985 GCCCCTCCCGACATGCATAGAGG - Exonic
1096740565 12:53690936-53690958 GGACATCTGGCCAGGCACAGTGG - Intergenic
1098441579 12:70524400-70524422 GTCAATCTGGCCAGGCATAGAGG - Intronic
1100506154 12:95222356-95222378 GGTCAACTGGACATCCATACGGG - Intronic
1102403065 12:112647698-112647720 AGCCATGTGGATATACATAGGGG + Intronic
1103525609 12:121565967-121565989 GGTCAACTGGACATCCATATGGG + Intronic
1111639488 13:90948734-90948756 GGCCATTTGAAAATACATAGAGG + Intergenic
1117089590 14:52236646-52236668 GGGCATCTGACCATGCAGAGGGG + Intergenic
1119048132 14:71339025-71339047 GGTAATCTGGCCATGCACAGTGG - Intronic
1120824806 14:88945483-88945505 GGCCCTCTAGACAGGCACAGAGG + Intergenic
1124688082 15:31799181-31799203 GGGCACCTGGACATGAACAGTGG + Intronic
1125802583 15:42463406-42463428 GGGCTTCTGGCCATGCAGAGTGG + Intronic
1125847965 15:42875617-42875639 GACCATCTGGCCAGGCACAGTGG + Intronic
1126896872 15:53267430-53267452 GACCATCTGTACAAGCATTGAGG - Intergenic
1127295902 15:57608254-57608276 GGACAGCTGGCCATGCATAGAGG + Intronic
1129582937 15:76831488-76831510 GGCCCTGTGGATGTGCATAGTGG - Intronic
1129883912 15:79025627-79025649 AGCCATCTGGCCCTGCAGAGAGG - Intronic
1132457888 16:34120-34142 GGCCATCTGGACACGCAGCCCGG + Intergenic
1135814829 16:25623004-25623026 GCCCATCTGGTCAGGCACAGAGG - Intergenic
1136056060 16:27690572-27690594 GCCCATTTGGAAATGCATGGAGG + Intronic
1136573865 16:31111981-31112003 GGCCATCTGGACATGCATAGTGG + Exonic
1136741043 16:32527069-32527091 GGACATCTGGGTATGCATTGAGG - Intergenic
1203028560 16_KI270728v1_random:548165-548187 GGACATCTGGGTATGCATTGAGG + Intergenic
1203043161 16_KI270728v1_random:786266-786288 GGACATCTGGGTATGCATTGAGG - Intergenic
1146688165 17:34855709-34855731 GACCATCAGGAGATGCACAGTGG + Intergenic
1157162845 18:45330297-45330319 GTCCAGCTGGACAGGCTTAGGGG - Intronic
1157379160 18:47195383-47195405 GGCCATATGAAAATACATAGAGG + Intergenic
1162065996 19:8125925-8125947 GGCCCTCTGGACACTCACAGCGG + Exonic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1165318955 19:35074386-35074408 GGCCATGTGGACAGGCAGGGAGG + Intergenic
1166295973 19:41889626-41889648 CACCATGTGGACATGCATAGTGG + Intronic
1166344626 19:42157432-42157454 CACCATCTGGAGATGCAGAGAGG - Intronic
1168726592 19:58586240-58586262 GGCCATCTGGACATGAAGCCTGG - Intergenic
927106964 2:19836144-19836166 GGCCATCGGCACGAGCATAGAGG + Intergenic
931625383 2:64252462-64252484 GGCCATCTGGGCATATATACGGG - Intergenic
933736101 2:85495687-85495709 GGCCATTTGAACATTTATAGAGG + Intergenic
934732450 2:96668130-96668152 GGCCCTCTGGACAAGCATGGTGG - Intergenic
936877648 2:117211749-117211771 GGCTATTTAGACATACATAGCGG - Intergenic
1172206476 20:33166302-33166324 GACCATCTGGCCAGGCATGGTGG - Intronic
1173017482 20:39238712-39238734 GGGCATCTGGACTAGCATATGGG + Intergenic
1174337251 20:49871742-49871764 GGCCATCTGGACAATCCCAGAGG - Intronic
1174857208 20:54057735-54057757 GGAAATTTAGACATGCATAGAGG + Intronic
1178268836 21:31170748-31170770 GACCATCTGGCCAGGTATAGTGG + Intronic
1178960571 21:37060940-37060962 GGCCACATGGACAAGCACAGTGG - Intronic
1182412860 22:30201961-30201983 GTCCATCTTCACATGCATATGGG + Intergenic
1182693953 22:32183788-32183810 GGCCATCTGGACTTCCTTTGGGG + Intergenic
1183056540 22:35310109-35310131 GTCCATCTGGAAATGCAGTGTGG - Intronic
1184520421 22:44990730-44990752 GGACATCTGGAGATGGATGGTGG + Intronic
1184836491 22:47025775-47025797 GGCAATATGGCCATGCTTAGAGG + Intronic
950583641 3:13878796-13878818 GGGGATCTGGGCATGGATAGAGG - Intronic
956253801 3:67262720-67262742 GGCAACCTGGACATGGGTAGTGG + Intergenic
958784122 3:98578102-98578124 GGCCATCTGGAGGTGCACTGTGG + Intronic
962272844 3:133990820-133990842 AGGCATCTGGCCAAGCATAGTGG + Intronic
970177646 4:13355462-13355484 GGTCATCTGGACGAGCACAGAGG + Intergenic
977690135 4:99896944-99896966 AGCCATCTGGAAATACATAGGGG - Exonic
978344647 4:107754480-107754502 GGCCACCTGGACAAGGAGAGGGG - Intergenic
978679929 4:111367936-111367958 GGCCATCTAAAGATGCATGGAGG + Intergenic
980457956 4:133069594-133069616 GTACATATGGAAATGCATAGTGG + Intergenic
981825453 4:148935614-148935636 GTGCATCTGTACATGTATAGAGG - Intergenic
985088209 4:186336925-186336947 GGCAAACTGGACATGCGTAGGGG - Intergenic
987827796 5:23055943-23055965 GACCATGTGGACCGGCATAGAGG + Intergenic
988519468 5:31932693-31932715 AGCCTTCTGGAGATGGATAGTGG - Intronic
988584794 5:32499109-32499131 GGCCACCTGGACAGGAATAAGGG + Intergenic
996669527 5:126100848-126100870 GGCCATCTGCCCATGCAAAAAGG - Intergenic
999573652 5:152948910-152948932 GGCCATTTAGAAATGCACAGAGG - Intergenic
1003186550 6:3836691-3836713 GGCCATCTGTACATGTTTTGAGG + Intergenic
1003632941 6:7804349-7804371 AGCCATCTGGCCATGCAAACTGG + Intronic
1013786022 6:113782010-113782032 GCCCATTATGACATGCATAGAGG - Intergenic
1015334524 6:132022217-132022239 TGCCATCTGGACATGCTCACAGG - Intergenic
1015342116 6:132112917-132112939 GGACATCTGGATATGCATACAGG - Intergenic
1017193881 6:151680485-151680507 GGCCATCTGGCCGGGCATGGTGG - Intronic
1018330412 6:162721527-162721549 GGCCTTCTAGACAGGCATGGAGG - Intronic
1019351437 7:555928-555950 GGGCATCTGGTCATGCATTGAGG - Intronic
1021856826 7:24865232-24865254 GGGAATGTGGACAAGCATAGGGG + Intronic
1025530838 7:61881123-61881145 GGACATCTGGGCATGCATTGAGG - Intergenic
1025580964 7:62716709-62716731 GGATATATGGACATGCATGGAGG + Intergenic
1025581957 7:62730678-62730700 GGATATTTGGGCATGCATAGGGG + Intergenic
1026176448 7:68001909-68001931 GGCCATGTGGGCAAGCAGAGAGG - Intergenic
1026438217 7:70418223-70418245 AGCCACCAGGCCATGCATAGTGG - Intronic
1026739758 7:72971551-72971573 GGCCTTCTGAGCATGCAGAGAGG + Intergenic
1027103974 7:75393519-75393541 GGCCTTCTGAGCATGCAGAGAGG - Intergenic
1029596543 7:101540559-101540581 GACCATCTGGCCGAGCATAGTGG + Intronic
1031758774 7:125682870-125682892 GGCTATCTGAAAATGCACAGAGG + Intergenic
1032757412 7:134904291-134904313 TGCCAGCTGGCCATGCATGGTGG + Intronic
1034647899 7:152664761-152664783 GGCCACCTGGACATTCCTTGGGG - Intronic
1036679595 8:10861485-10861507 GGACATCTGGACTTGCTCAGAGG - Intergenic
1038038329 8:23704695-23704717 GGCCATCTCCACTTGCAAAGAGG + Intronic
1049187363 8:141264242-141264264 GGCCACCGGGAGATGCAAAGTGG - Intronic
1055470049 9:76602096-76602118 GGCCATATGGACAAGCTTCGGGG - Intergenic
1056741158 9:89256608-89256630 GGCCATCTGGAGAAGAATGGGGG + Intergenic
1057150607 9:92792914-92792936 GGCCATCTGGGCCTACACAGTGG + Intergenic
1057444518 9:95104295-95104317 GGCCATCTGGGCACCCATCGTGG - Intronic
1057871213 9:98719272-98719294 GGCCATCTGGACTTCCTTTGGGG + Intergenic
1189851786 X:45185212-45185234 TAGCATGTGGACATGCATAGAGG + Intronic
1194822336 X:98524628-98524650 GGCCATCTGGGCATATACAGTGG + Intergenic
1200398492 X:156005363-156005385 GGCCATCTGGACACGCAGCCTGG - Exonic