ID: 1136574028

View in Genome Browser
Species Human (GRCh38)
Location 16:31112634-31112656
Sequence CACGAACCAGTTCAACCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 48}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136574028_1136574039 27 Left 1136574028 16:31112634-31112656 CCCTTGGGTTGAACTGGTTCGTG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1136574039 16:31112684-31112706 CTGGCAGGCCAGGAGTAGAATGG 0: 1
1: 0
2: 3
3: 21
4: 276
1136574028_1136574036 17 Left 1136574028 16:31112634-31112656 CCCTTGGGTTGAACTGGTTCGTG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1136574036 16:31112674-31112696 CCCTGAGAGCCTGGCAGGCCAGG 0: 1
1: 0
2: 5
3: 51
4: 537
1136574028_1136574032 8 Left 1136574028 16:31112634-31112656 CCCTTGGGTTGAACTGGTTCGTG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1136574032 16:31112665-31112687 TCTTACCTGCCCTGAGAGCCTGG 0: 1
1: 0
2: 0
3: 22
4: 241
1136574028_1136574040 28 Left 1136574028 16:31112634-31112656 CCCTTGGGTTGAACTGGTTCGTG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1136574040 16:31112685-31112707 TGGCAGGCCAGGAGTAGAATGGG 0: 1
1: 0
2: 3
3: 17
4: 151
1136574028_1136574033 12 Left 1136574028 16:31112634-31112656 CCCTTGGGTTGAACTGGTTCGTG 0: 1
1: 0
2: 0
3: 5
4: 48
Right 1136574033 16:31112669-31112691 ACCTGCCCTGAGAGCCTGGCAGG 0: 1
1: 0
2: 4
3: 36
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136574028 Original CRISPR CACGAACCAGTTCAACCCAA GGG (reversed) Intronic