ID: 1136579709

View in Genome Browser
Species Human (GRCh38)
Location 16:31143822-31143844
Sequence GCCCCCCAGAGTCACCCTAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136579701_1136579709 6 Left 1136579701 16:31143793-31143815 CCAGCGGCCGCCTTCCTCACAGA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG 0: 1
1: 0
2: 3
3: 15
4: 115
1136579704_1136579709 -1 Left 1136579704 16:31143800-31143822 CCGCCTTCCTCACAGACCAGGGG 0: 1
1: 0
2: 4
3: 36
4: 344
Right 1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG 0: 1
1: 0
2: 3
3: 15
4: 115
1136579707_1136579709 -8 Left 1136579707 16:31143807-31143829 CCTCACAGACCAGGGGCCCCCCA 0: 1
1: 1
2: 2
3: 38
4: 321
Right 1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG 0: 1
1: 0
2: 3
3: 15
4: 115
1136579699_1136579709 17 Left 1136579699 16:31143782-31143804 CCTGCCTGGAACCAGCGGCCGCC 0: 1
1: 0
2: 2
3: 21
4: 174
Right 1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG 0: 1
1: 0
2: 3
3: 15
4: 115
1136579706_1136579709 -4 Left 1136579706 16:31143803-31143825 CCTTCCTCACAGACCAGGGGCCC 0: 1
1: 0
2: 2
3: 43
4: 304
Right 1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG 0: 1
1: 0
2: 3
3: 15
4: 115
1136579700_1136579709 13 Left 1136579700 16:31143786-31143808 CCTGGAACCAGCGGCCGCCTTCC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG 0: 1
1: 0
2: 3
3: 15
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136579709 Original CRISPR GCCCCCCAGAGTCACCCTAG TGG Exonic
900504072 1:3020489-3020511 GCCCCCCAGAGTTCTCCCAGAGG - Intergenic
900927107 1:5712630-5712652 GCCACTCAGAGTGAACCTAGGGG - Intergenic
902612617 1:17606037-17606059 GCCCCCCAGCTTCACCCCACAGG - Intronic
903664142 1:24996378-24996400 GCCCCCCAGCCTCCTCCTAGTGG + Intergenic
904079609 1:27863701-27863723 GGCCCCCATGGTCACCCTGGTGG + Intergenic
908575763 1:65458229-65458251 ACCTCCTAGAGTCACCATAGTGG + Intronic
910663782 1:89702180-89702202 GCCCCCCAGAGTCCACCAATAGG - Intronic
916747775 1:167697666-167697688 ACCCCCCACAGTCCCCCTGGAGG + Exonic
920055360 1:203186926-203186948 GCCCCCCATCATCACCCTAGTGG - Intergenic
920386956 1:205576154-205576176 GCCTCCCAGGGTCACCCCAAAGG + Intronic
923031647 1:230253736-230253758 GGTCCCTAGAGTCACCCTACCGG + Intronic
1063966810 10:11352431-11352453 GCCCCCCAGAGCCACACCTGTGG + Intergenic
1069956269 10:72053833-72053855 GACCCCCAGGATCACCCTGGAGG - Intergenic
1071902521 10:90136350-90136372 GCTCCCCAGAGAAACCCTAGAGG - Intergenic
1074454879 10:113588198-113588220 GGCCTCCAGAGTCACCCTAAGGG - Exonic
1075602265 10:123778461-123778483 GTCTCCCAGTGTCACCCAAGGGG + Intronic
1076764314 10:132624830-132624852 GCCCCACAGTGTCACCCTCCTGG + Intronic
1077056768 11:597725-597747 GCACCCCAGGGTGACCCCAGCGG + Intronic
1077177855 11:1198717-1198739 GCCACCACGAGTCACCCCAGGGG + Intronic
1077436293 11:2540744-2540766 GCCTCCCATTGCCACCCTAGAGG - Intronic
1079025813 11:16946798-16946820 CCCCCACAGAGACAACCTAGGGG + Intronic
1083142475 11:60733433-60733455 GTGCCCCAGAATCACCCCAGGGG - Intronic
1084484056 11:69437885-69437907 GCCCCCCAGACCCACCCTGAGGG - Intergenic
1092406370 12:8224512-8224534 GCCCCCAAGAGTCTCTCAAGGGG + Intronic
1095308499 12:40665950-40665972 ACCCCTCAAAGTCACCCTAGAGG - Intergenic
1096404037 12:51329818-51329840 GGCCCCCAGAGTCACCCTGCAGG + Exonic
1101759716 12:107648709-107648731 GCATCCCAGAGTCACCCTCTGGG + Intronic
1102034509 12:109763076-109763098 GGACCACAGAGTCAGCCTAGAGG - Intronic
1102426768 12:112849925-112849947 GACCCCCAGAGGCAGCCCAGTGG - Intronic
1103536535 12:121637518-121637540 GCCCCCCATACACACCCCAGCGG + Intronic
1107727951 13:43318950-43318972 GCCCCACAGAGTCAACCTGGAGG + Intronic
1114683323 14:24505644-24505666 GGCCCCCAGAGTCTCCCTGTAGG + Exonic
1117405335 14:55396727-55396749 GCTCCCTAGATGCACCCTAGAGG - Intronic
1118045363 14:61964360-61964382 GCCCCACAAAGTCATCCAAGAGG - Intergenic
1118710052 14:68511421-68511443 AGCTCCCAGAATCACCCTAGGGG + Intronic
1121444416 14:93969601-93969623 GCCTCCCAGAGTGTCCCTTGAGG - Intronic
1129233425 15:74209260-74209282 GGCCCTCAGAGTCACCTCAGTGG + Intronic
1132704564 16:1237513-1237535 GCCCTCCCGAGTCACCCTGAGGG + Intergenic
1132706949 16:1248912-1248934 GCCCTCCCGAGTCACCCTGAGGG - Intergenic
1132989266 16:2784787-2784809 GTCCCCCAGAATCACCCTGCAGG + Exonic
1132999009 16:2839916-2839938 GCCCCCCGGAGTCACCCTGGGGG + Intergenic
1136579709 16:31143822-31143844 GCCCCCCAGAGTCACCCTAGTGG + Exonic
1139750912 16:69108243-69108265 GCCCCGAAGAGCTACCCTAGTGG - Intronic
1140468958 16:75204307-75204329 GGCCTCCAGAGTCACCCTGCAGG + Exonic
1142512045 17:402214-402236 GCCTCCCAGAGTCCTCCCAGAGG + Intergenic
1143848313 17:9790171-9790193 GCCCCCCAGAGGGACTCTCGGGG + Intronic
1145039620 17:19567622-19567644 GCCCTGCAGAGTCACCCTCAGGG - Intronic
1148446254 17:47739369-47739391 GGCCTCCCGAGTCACCCGAGCGG - Intronic
1148688583 17:49513991-49514013 GGCCCCTAGAATCAGCCTAGGGG + Exonic
1151357659 17:73570114-73570136 GCCCCCCAGAGCCCCTCTTGGGG + Intronic
1152363564 17:79843260-79843282 GCCCCCGAGTCCCACCCTAGCGG + Intergenic
1152636937 17:81434077-81434099 TCCCCCCACAGTGACCCCAGGGG - Intronic
1153410680 18:4789337-4789359 GCCCCCCAGATACCTCCTAGGGG + Intergenic
1153738948 18:8102668-8102690 ACCCCTCAAAGTCACCCTTGAGG + Intronic
1158351141 18:56566015-56566037 GTCCCCCAGAGTCCCCCCTGAGG + Intergenic
1160710672 19:549623-549645 GCCCGCCCGAGTCACCCTGCAGG - Exonic
1160777599 19:863085-863107 GGCCCCCGGAGTCACCCTGCCGG - Exonic
1161101991 19:2425920-2425942 GTCCCCCAGCGTCACCCTGTTGG - Exonic
1161155793 19:2731471-2731493 GCCCCCCCCAGTCAGCCTTGTGG + Intronic
1162490565 19:10988918-10988940 ACCCCTCGGAGTGACCCTAGAGG - Intronic
1164898316 19:31896786-31896808 CCTCCCCCGAGTCACCCTCGCGG + Intergenic
1167666574 19:50825933-50825955 GTCCCCCAGAGTCACCCTGTGGG + Exonic
1167672257 19:50859965-50859987 GGCCCCCAGAATCACCCTAAGGG - Exonic
1167675009 19:50878397-50878419 GACCCCCAGAATCACCCTAAGGG - Exonic
1167683948 19:50943771-50943793 GCCCCCCAGAATCACCCTGCAGG + Exonic
1167686379 19:50959301-50959323 GACCCCCAGAATCACCCTGCAGG + Exonic
1167689695 19:50977676-50977698 GTCCCCCTGAGTCACCCTAGAGG + Exonic
1167695751 19:51014937-51014959 GGCCTCCAGAGTCACTCTGGGGG + Exonic
1167705315 19:51078144-51078166 GTCCCCCAGAGTCACCCTGAGGG + Exonic
928440645 2:31289280-31289302 GCCTACCACAGTCTCCCTAGTGG + Intergenic
929027639 2:37620028-37620050 GCCACCCTTAATCACCCTAGTGG + Intergenic
931818777 2:65930903-65930925 TCCTCCCAAAGTCACCATAGAGG - Intergenic
933906423 2:86898094-86898116 GCCCCTCAAAGTCACCCATGAGG - Intergenic
934025047 2:87995555-87995577 GCCCCTCAAAGTCACCCATGAGG + Intergenic
935776125 2:106473650-106473672 GCCCCTCAAAGTCACCCATGAGG + Intergenic
936365744 2:111853588-111853610 GCCCCTCAAAGTCACCCATGAGG + Intronic
937935672 2:127242058-127242080 GCCCCACAGAGTCCCCATTGGGG - Intergenic
938063888 2:128270872-128270894 TGCCCTCAGAGTCACCCTTGGGG - Intronic
938411574 2:131069055-131069077 GGCCCCCACAGGCACCCAAGGGG + Intronic
1171298218 20:24037279-24037301 GTCCCCAAGAGCCTCCCTAGAGG - Intergenic
1171988134 20:31675149-31675171 GCCCTCCAGAGTCACCCAAGAGG - Intronic
1173525808 20:43731737-43731759 GCCCCCCAGAGCATCCCTGGAGG + Intergenic
1175167858 20:57058285-57058307 ACCCCTCAGAGTCACCCATGAGG + Intergenic
1175189165 20:57199595-57199617 GTCCTTCAGGGTCACCCTAGGGG - Intronic
1175224555 20:57437448-57437470 GCCCATCAGAGTCACCTGAGGGG + Intergenic
1175293388 20:57893085-57893107 GCCCCCCAGCTTCTCCCCAGAGG - Intergenic
1176050053 20:63114315-63114337 GTCCCCCAGAGACACACTGGAGG + Intergenic
1177617098 21:23537164-23537186 GCCCATCAGAGTAAGCCTAGAGG - Intergenic
1178432104 21:32525960-32525982 GCCCCCCAAACTCCCCCCAGGGG + Intergenic
1184298299 22:43540048-43540070 GGCCCCCAAAGTCCCCCCAGTGG + Intronic
1184391699 22:44206884-44206906 GGGCCCCAGAGTCACCCTCCAGG + Exonic
1185262020 22:49872433-49872455 GCCCCTCAGAGTCATCCATGAGG + Intronic
954154653 3:48678778-48678800 GGATCCCAGAGTCACCCCAGGGG + Intronic
957119689 3:76073905-76073927 GCCCCACAGAGACACCATATTGG - Intronic
970694405 4:18660052-18660074 GCCCCCAAAAGTCACCCTGCAGG - Intergenic
973087780 4:46089515-46089537 CCCCCACAGTGTCACCCTAGTGG + Intronic
974733623 4:65900345-65900367 GCCCCCCACAGTATCCCTAGTGG + Intergenic
974943459 4:68496636-68496658 GTCCTCCAGAGTCACCCTAAAGG - Exonic
976220510 4:82753448-82753470 GCGCCCCAGAGTCACGCGGGTGG + Intronic
985615392 5:917007-917029 GGCCCCCACCGTCACCATAGAGG + Exonic
985937741 5:3109709-3109731 GACCCCCAGATTCACCATGGAGG - Intergenic
989229048 5:39066009-39066031 GCCCCCCAGAGTCCCCAGTGGGG - Intronic
990286322 5:54303819-54303841 GCCCCCAAAAGTGACACTAGGGG + Intronic
997104228 5:131000240-131000262 GCTCCCCAAAGTCCCACTAGGGG - Intergenic
1001772462 5:174306465-174306487 TCCAGCCAGAGTCACCCTTGTGG - Intergenic
1002175310 5:177398196-177398218 GCCCCCCAGGGTCTTCCTGGAGG + Exonic
1002446661 5:179294448-179294470 GCCCAGCAGACCCACCCTAGGGG + Intronic
1002771105 6:291897-291919 GGCCCCCGGAGTCGCCCCAGGGG + Intronic
1006361655 6:33590366-33590388 GCCCCCCTGAGTCAGCCAGGAGG + Intergenic
1007590321 6:43017031-43017053 GCCTCCAAGTGTCACCCTGGGGG - Intronic
1016927021 6:149361146-149361168 GCCCCACAGAGTCTCCATGGGGG - Intronic
1018351413 6:162962970-162962992 GTCCCTCAAAGTGACCCTAGAGG - Intronic
1018406049 6:163483711-163483733 ACCCCTCAGAGTCATCCTTGAGG + Intronic
1019929608 7:4214980-4215002 GCCCCCCAGTGCCACCCAGGTGG + Intronic
1022930747 7:35111082-35111104 ACCCCTCAGAGTCACCCATGAGG - Intergenic
1028960480 7:96743538-96743560 GCCACAGAGAGTTACCCTAGGGG - Intergenic
1029277523 7:99416014-99416036 GCCACCCACAGCCATCCTAGTGG + Intronic
1029378830 7:100199406-100199428 CCCTCCCAGTTTCACCCTAGGGG - Intronic
1032122581 7:129167973-129167995 GCCCCCCAGTGACAGCCCAGTGG + Exonic
1033582915 7:142752861-142752883 GGCCACCAGAATCACCCTGGGGG - Exonic
1033585941 7:142774349-142774371 GGCCACCAGAATCACCCTGGGGG - Intergenic
1036634310 8:10538469-10538491 GCCCCCCACTGTCACCCTGTGGG - Exonic
1036846747 8:12175451-12175473 GCCCCCAAGAGTCTCTCAAGGGG + Intergenic
1036868112 8:12417770-12417792 GCCCCCAAGAGTCTCTCAAGGGG + Intergenic
1039804018 8:40983487-40983509 ACACCCCAGAGTCAATCTAGAGG + Intergenic
1040329538 8:46378803-46378825 GTCCCCCAGAGTCCCCCCTGCGG - Intergenic
1056786192 9:89594099-89594121 TCCCTCCAAAGCCACCCTAGAGG - Intergenic
1059718886 9:116939438-116939460 CCCTCCAAGAGTCACCCTGGAGG + Intronic
1060936354 9:127518343-127518365 GCCACCCAGAATGGCCCTAGAGG + Intronic
1061167914 9:128934988-128935010 GCTCCCTAGAGCCACCCTAAGGG + Intronic
1062168505 9:135121383-135121405 GCGCCCCAGAGTCACCTAAGAGG - Intergenic
1186488194 X:9950318-9950340 GCCCGCCAGAACCACCCGAGAGG + Intergenic
1189532621 X:41902020-41902042 GGCCTCCAGACTCACCCTGGCGG - Intronic
1200204764 X:154307897-154307919 GCCCCCCAGAGACTCCCTTTTGG - Intronic