ID: 1136579746

View in Genome Browser
Species Human (GRCh38)
Location 16:31143978-31144000
Sequence TTTCTTCTGTTTAGAGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136579746_1136579753 25 Left 1136579746 16:31143978-31144000 CCTGCGGCTCTAAACAGAAGAAA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1136579753 16:31144026-31144048 AGCCAGAGCCAAGAGCACCAGGG 0: 1
1: 0
2: 4
3: 33
4: 272
1136579746_1136579747 -6 Left 1136579746 16:31143978-31144000 CCTGCGGCTCTAAACAGAAGAAA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1136579747 16:31143995-31144017 AAGAAATCCCTGTAAGCAGAAGG 0: 1
1: 0
2: 2
3: 24
4: 257
1136579746_1136579749 1 Left 1136579746 16:31143978-31144000 CCTGCGGCTCTAAACAGAAGAAA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1136579749 16:31144002-31144024 CCCTGTAAGCAGAAGGCCGATGG 0: 1
1: 0
2: 1
3: 11
4: 112
1136579746_1136579754 26 Left 1136579746 16:31143978-31144000 CCTGCGGCTCTAAACAGAAGAAA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1136579754 16:31144027-31144049 GCCAGAGCCAAGAGCACCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 278
1136579746_1136579752 24 Left 1136579746 16:31143978-31144000 CCTGCGGCTCTAAACAGAAGAAA 0: 1
1: 0
2: 0
3: 9
4: 118
Right 1136579752 16:31144025-31144047 CAGCCAGAGCCAAGAGCACCAGG 0: 1
1: 0
2: 4
3: 39
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136579746 Original CRISPR TTTCTTCTGTTTAGAGCCGC AGG (reversed) Intronic
911559352 1:99385115-99385137 TTTCTTCTTTTTAGAGGAGGTGG - Intergenic
919656066 1:200198394-200198416 TTTCTTATGTAGAGAGCTGCAGG + Intergenic
920219011 1:204382339-204382361 CTTCTTCTGTTAATAGCTGCAGG + Intergenic
921742299 1:218699462-218699484 TTTCTTCTTTTCAGAGTTGCTGG + Intergenic
921952503 1:220945176-220945198 CTTCTTCTGTCTAGAGCCCCAGG - Intergenic
1064258118 10:13762572-13762594 TTTCTTCTGTGTATGGCCGTGGG + Intronic
1065264095 10:23957142-23957164 GTTGTTCTGCTTAGAGCAGCTGG - Intronic
1068343249 10:55736912-55736934 TTGCTTCTGGTAAGAGCCTCAGG + Intergenic
1072343315 10:94477641-94477663 TTTCTTCTGTTTATGGATGCAGG + Intronic
1074329945 10:112496200-112496222 TTTATTTTGTTTAGAGACGGCGG - Intronic
1074488547 10:113915196-113915218 TTTGTTCTGTTGAAAGCCACAGG + Exonic
1074547089 10:114409401-114409423 TTTGTTTTGTCTAGAGCCTCTGG - Intergenic
1074757448 10:116635021-116635043 TTTCTTCTGTTCTAAGCCACAGG - Intronic
1076206250 10:128606794-128606816 TTTATTCTGCTGAGAGCCGTAGG + Intergenic
1085804924 11:79626787-79626809 TTTCTTCTTTTTAGGGCCTGAGG + Intergenic
1086473042 11:87137943-87137965 TTACTTCTGTTTAGAGATGTGGG - Intronic
1087291810 11:96328300-96328322 TTTCTTCTGTTAAGATTTGCTGG - Intronic
1088940348 11:114447810-114447832 TTTCTGCTGTGTATAGACGCTGG + Exonic
1097935991 12:65251686-65251708 TTCCTTCTTTTGACAGCCGCAGG - Intergenic
1099561381 12:84179595-84179617 TTTCTACTGTTTACATCCTCTGG + Intergenic
1100724829 12:97397340-97397362 TTTCTCCTGATAAGAGCAGCAGG + Intergenic
1100728417 12:97435502-97435524 TTTCTTCTGATAAGAGCCTGTGG - Intergenic
1101688542 12:107050576-107050598 TTGCTTCTGTTGAGGGCCTCAGG - Intronic
1104910788 12:132240025-132240047 CTTCCTGTGTTTAGAGCGGCGGG - Intronic
1105022542 12:132826959-132826981 TCTCTTCTCTCTAGAGACGCAGG - Intronic
1109645274 13:65245870-65245892 TTTCTTGTGTGTACAGCCACTGG + Intergenic
1113529365 13:111009824-111009846 TTTCTCCTGTTCAGAGCATCAGG - Intergenic
1114255863 14:21000994-21001016 TGTCTTCTTTTTGGAGTCGCTGG + Exonic
1119739603 14:77005675-77005697 TTTCTTCTGTATAGTGACCCTGG - Intergenic
1125286237 15:38095631-38095653 TTTCTGCTGTTTATATTCGCTGG + Intergenic
1126550861 15:49927759-49927781 TATCTTCTATTTACAGCCTCAGG - Intronic
1135817306 16:25646777-25646799 TTTCTTCTGTGTAGAGCACAGGG + Intergenic
1136579746 16:31143978-31144000 TTTCTTCTGTTTAGAGCCGCAGG - Intronic
1138997935 16:62476407-62476429 TTGCTTCTTTGTAGAGCTGCTGG + Intergenic
1140622639 16:76754585-76754607 TTTCTTTTATTTAGAGCAGATGG - Intergenic
1142881972 17:2888983-2889005 ATTCTTCTGTTTATAGACTCAGG + Intronic
1145737737 17:27244840-27244862 TATCTTCTTTTTGGAGCCACTGG - Intergenic
1146773498 17:35590619-35590641 TCCCTTCTCTTTAGAGCAGCAGG + Intronic
1150826449 17:68480364-68480386 TTTCTTCTGTTAGGTGCCCCAGG + Intergenic
1153235355 18:2980804-2980826 TTTCTGCAGTTTAGAGCTGGGGG - Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1156174486 18:34526896-34526918 TTTCATCTGTTAAGAGGTGCAGG + Intronic
1158328690 18:56337891-56337913 TTTCTTCTGGTGAGAGCCTCAGG - Intergenic
1160038601 18:75322928-75322950 TTTCTTCCCCTTAGGGCCGCGGG + Intergenic
1160978545 19:1806154-1806176 TTTCTTCTGCTTGAAGCTGCGGG + Exonic
1164782171 19:30901564-30901586 TGTCTTCTGTCTAAAGCCCCCGG - Intergenic
1165152517 19:33769430-33769452 TTTCTTCTGGTTATGGCAGCTGG - Intronic
927502743 2:23593236-23593258 TTTCTTCATTTTTGAGCCTCAGG - Intronic
928206433 2:29287910-29287932 TTTCTTTTGTTTACAGCTCCTGG + Intronic
930434941 2:51328927-51328949 CTCCTTCTGTTTAGGGCCACAGG - Intergenic
930500720 2:52214156-52214178 TTTCTTCTGGTGAGGGCCTCAGG + Intergenic
932864549 2:75327923-75327945 TTTCTCCTGTTTCTAGCCACGGG + Intergenic
935224271 2:101039443-101039465 TTTCTTCTTTTTAGAGAGGAGGG - Intronic
944579504 2:201119131-201119153 TTTCTTCCCTGTAGAGCCCCAGG + Intronic
945591927 2:211744462-211744484 TTTCTTCTGTTTAAAACCTCTGG + Intronic
1170685043 20:18562232-18562254 TTTCTTCTGTTTGGAATCTCGGG + Intergenic
1172163936 20:32887247-32887269 TTTCTTCAGTTCAGAGCCTGTGG + Intronic
1173155555 20:40605711-40605733 TTTCCTCTCTTGAGAGCCCCTGG + Intergenic
1173497722 20:43531323-43531345 TTTCCTCTGTTCAGGGCAGCTGG + Intronic
1175300581 20:57940191-57940213 TTTCTAGTGTTTAGAGCCCAAGG - Intergenic
1178628130 21:34235443-34235465 TTTCTGCTGTTCAGAGCTCCAGG + Intergenic
1181454036 22:23045049-23045071 TTTTTTTGGTTTAGAGCCTCTGG - Intergenic
1184747808 22:46466142-46466164 CTTCTTCTCCTTAGAGCCACTGG - Intronic
949461610 3:4300842-4300864 TTTCTACTGATTAGAGCTCCAGG - Intronic
956877149 3:73475097-73475119 TTTCTTCTGTGTAGAGCTGGTGG - Intronic
957232548 3:77538920-77538942 TTTCTTCTTTTTAGAGACGGAGG + Intronic
957434053 3:80151699-80151721 TTTCTTCTGTATAGAGTGTCTGG + Intergenic
962858060 3:139367633-139367655 TTTTTTCTGTTTTGAGCCTAAGG - Intronic
964880968 3:161422518-161422540 TTTCTGCTCTTCAGAGCAGCTGG + Intergenic
970025411 4:11618680-11618702 TTTCTTCTGAAAAGAGCCCCTGG - Intergenic
970196706 4:13558312-13558334 TTTTTTCTTTTTAGAGTCGGCGG - Intergenic
975455977 4:74590347-74590369 TTTCTTCTACCTAGAGCCCCGGG - Intergenic
982116308 4:152101043-152101065 TTTCCTCTGCTTAGAACCTCTGG - Intergenic
983983555 4:174029188-174029210 TTTCTTCTCTTTGAAGCCCCAGG - Intergenic
989669261 5:43895505-43895527 TTGCTTCAGTTCAGAGCCTCAGG + Intergenic
990324102 5:54657623-54657645 TTACTTCTGGTTAGGGCCGGTGG - Intergenic
991356180 5:65771536-65771558 TTTATTTTTTTTAGAGCGGCAGG + Intronic
991587194 5:68213624-68213646 TTCCTTCTGTCTAGAACCTCTGG - Intergenic
993784596 5:92113611-92113633 TGTGTTCAGTTTAGAGCCTCAGG - Intergenic
997615743 5:135245007-135245029 CTTCTTCTGTTTAGAGGGGCCGG + Intronic
1000250988 5:159495387-159495409 ATTCTTCTGCTTATAGCCTCAGG - Intergenic
1006996628 6:38267225-38267247 TTTCTTCTGTTAATAGCTGAAGG + Intronic
1008226322 6:48920959-48920981 TTGCTTCTGGTTAGGGCCTCAGG - Intergenic
1010019002 6:71138640-71138662 TCTCTTCTCTGTAGAGCTGCTGG - Intergenic
1013398571 6:109768845-109768867 TTTCTATTGTTTTGAGCCACCGG - Intronic
1017691054 6:156965135-156965157 TTTCTTTTGCATAGAGCAGCTGG + Intronic
1018354680 6:163000468-163000490 TCTCTTCTGTTTGGAGCGACAGG - Intronic
1018796139 6:167186965-167186987 TTTCTGTTGTTTGGAGCTGCTGG + Intronic
1018820182 6:167368092-167368114 TTTCTGTTGTTTGGAGCTGCTGG - Intronic
1019861243 7:3659912-3659934 TTGCTTCTGATTAGAGCCCTTGG + Intronic
1020603972 7:10311608-10311630 TTTCTTCTGATTAGAGCTCTTGG - Intergenic
1022056187 7:26736888-26736910 TTTTTTCTTTTTAGAGATGCGGG - Intronic
1026150790 7:67786510-67786532 TTTCAGCTGCTTAGAGCTGCTGG - Intergenic
1030979366 7:116167875-116167897 TTTCTTTTGTTTTAAGCCACTGG + Intergenic
1031083135 7:117277814-117277836 TTTCTTCTTTCTAGAGCAGTTGG - Exonic
1032234856 7:130111798-130111820 TTTCTTCTTTTTGGAACTGCCGG - Intronic
1032749846 7:134827796-134827818 ATTCTTCTGTTTAAAGCTACCGG + Intronic
1036664308 8:10729139-10729161 TTTCTGCTGGCTAAAGCCGCAGG - Intronic
1038327941 8:26586662-26586684 TTCCTTCTGTTTAGGGACGAGGG + Intronic
1038502369 8:28055824-28055846 TTTCTTTTGTTTTGAGACGCGGG - Intronic
1039130089 8:34253794-34253816 TTTCTTTTGTTGAAAGCAGCAGG + Intergenic
1043484557 8:80686385-80686407 TTTGTTTTGTTTAAAGCAGCAGG + Intronic
1044345429 8:91098897-91098919 TTTCATCTATTTAGAACCTCAGG - Intergenic
1044391392 8:91656336-91656358 TTTCTTCTGTTCTCAGCCCCTGG - Intergenic
1046900081 8:119514503-119514525 TTTCTGCTGTTTATATTCGCTGG + Intergenic
1048147648 8:131861382-131861404 TTTCTTCTATTTAGAAGGGCAGG + Intergenic
1049333153 8:142065708-142065730 TTTCTGCTGTTTTCAGCCACCGG + Intergenic
1050702395 9:8355259-8355281 TTGCTTCTGTTGAGGGCCCCAGG - Intronic
1051410803 9:16787721-16787743 TTTCTTCTTTGTAGAGACGAGGG + Intronic
1052314114 9:27098317-27098339 TTGCTTCTGGTTAGGGCCTCAGG - Intergenic
1052406370 9:28066085-28066107 TTTCATTTGTTTAAAGCCCCTGG + Intronic
1055374474 9:75634255-75634277 TTTCCTCTGTTTGGATCGGCAGG + Intergenic
1055518505 9:77057380-77057402 TTTCTTCTGTTTAGATCAACAGG - Intergenic
1056469575 9:86892710-86892732 TTTGTTCTGTTGAGACCTGCAGG + Intergenic
1059542254 9:115142687-115142709 TTTCTTATGGTTAGAGAGGCTGG - Intronic
1061348570 9:130045490-130045512 TTTCTCCTCTTTAAAGCAGCAGG - Intergenic
1061542827 9:131287516-131287538 TTTCGTCTGGCTAGAGCTGCTGG - Intergenic
1061595011 9:131623286-131623308 TTTTTTCTTTTTAGAGACGGGGG - Intronic
1185798957 X:2992032-2992054 TTACTTCTGTATAGATCCTCAGG + Intergenic
1187423394 X:19156103-19156125 TTTCTTCTCTTTTGATCTGCAGG + Intergenic
1187583225 X:20631604-20631626 TTACTTCTGTTGAGAACCGCTGG - Intergenic
1189301104 X:39952959-39952981 TTGCCTCAGTTTAGAGCTGCTGG - Intergenic
1190030230 X:46965286-46965308 TTGCTTCTGTTCAGAGTGGCAGG + Intronic
1195911022 X:109888336-109888358 TTTCTTTTTTTTAGAGATGCAGG - Intergenic
1196774647 X:119327175-119327197 GATCCTCTGCTTAGAGCCGCAGG + Intergenic
1196937244 X:120742180-120742202 GTTTTTCTGTTAAGAGCAGCTGG - Intergenic
1197754750 X:129985505-129985527 TTGCTTCTATTTGGAGCCCCGGG - Intronic
1199234540 X:145475637-145475659 TGTCTTTTGTTTAGAGTCTCTGG - Intergenic