ID: 1136584421

View in Genome Browser
Species Human (GRCh38)
Location 16:31174778-31174800
Sequence ACTGGGGCCTTGGGGGTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 3, 3: 57, 4: 357}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136584421_1136584433 23 Left 1136584421 16:31174778-31174800 CCCAGGACCCCCAAGGCCCCAGT 0: 1
1: 0
2: 3
3: 57
4: 357
Right 1136584433 16:31174824-31174846 AGCACCTCCACTGCCAAAGGAGG No data
1136584421_1136584432 20 Left 1136584421 16:31174778-31174800 CCCAGGACCCCCAAGGCCCCAGT 0: 1
1: 0
2: 3
3: 57
4: 357
Right 1136584432 16:31174821-31174843 GTGAGCACCTCCACTGCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136584421 Original CRISPR ACTGGGGCCTTGGGGGTCCT GGG (reversed) Intergenic
900252540 1:1678589-1678611 ACTGAGGCCTGGGGTGCCCTTGG - Intronic
900494129 1:2968814-2968836 ACTGGGGCCTGGCGAGGCCTGGG - Intergenic
900759901 1:4463545-4463567 AGTGAGGCCTTTGGGGTCCTTGG - Intergenic
901689119 1:10961050-10961072 ACTGGGGCATTGGGGCATCTGGG + Intronic
901859993 1:12068230-12068252 CCTGGAGGCTTGAGGGTCCTTGG + Intronic
902106897 1:14045052-14045074 ACTGGCCCCTTGGGGCTCCTTGG - Intergenic
902377453 1:16036547-16036569 GCTGGGTCCTTGGGGGGCCCAGG - Intergenic
902546629 1:17194356-17194378 TCTGGGGCCTCGGGGCTCCTGGG + Intergenic
903212192 1:21824497-21824519 GCTGGGCTCTTGGGGCTCCTGGG - Exonic
903267911 1:22169333-22169355 ACAGGGGTCCTGTGGGTCCTTGG - Intergenic
903420847 1:23217191-23217213 CCTGGGGCCTCGGGGGCCCGGGG - Intergenic
904260341 1:29284205-29284227 AGTTGGGCCTTGGGGGTGATGGG + Intronic
904276376 1:29387391-29387413 CCTGGGGCCATGGGGGAGCTTGG + Intergenic
904900524 1:33853718-33853740 ACTGAGGCCATGGGAGTGCTGGG + Intronic
905400755 1:37701373-37701395 CCTGGGGCCTGGGAGGTCCCTGG - Intronic
905799692 1:40835177-40835199 AGTGAGCCCTTGGGGGTGCTCGG - Intronic
909827643 1:80145708-80145730 ACTGGGGCCTTTTGGGGGCTAGG + Intergenic
910294355 1:85629362-85629384 GCTGGGGCCTGGTGAGTCCTAGG + Intergenic
911144876 1:94542035-94542057 CCGGGGGCCTTGGGGGACCCGGG - Intergenic
912800992 1:112719628-112719650 TTTTGGGCCTTGGGGTTCCTAGG + Intergenic
914226173 1:145721167-145721189 AGTTGGGCCTGGTGGGTCCTGGG - Intronic
915557628 1:156669279-156669301 ACTGGGGACTTAGGGGTGCGGGG - Exonic
916166901 1:161972862-161972884 ACTGGGCCCTGGTGGGTTCTAGG + Intergenic
916384294 1:164249946-164249968 ACTGGGGCCTTGGGAGTCACAGG + Intergenic
916548465 1:165828121-165828143 ACTCGGGCCTTGGGGGTTCCGGG + Intronic
916563908 1:165956697-165956719 AATGGGGCTTTGGGGCTCATTGG - Intergenic
917648214 1:177049207-177049229 TCCTGTGCCTTGGGGGTCCTGGG - Intronic
918439439 1:184551709-184551731 AAAGGGGCTTTGGGGGTCCAGGG + Intronic
920864790 1:209743058-209743080 ACTAGGGCCTTCGGGGACCTGGG + Intergenic
921104151 1:211959372-211959394 AGTGCAGCCTTGGGTGTCCTGGG + Intronic
922484707 1:225964388-225964410 GCTGGGGCCCTGGGGGCCCTGGG - Intergenic
922795925 1:228339827-228339849 GCTGGGGCCCTGTGGCTCCTGGG - Intronic
923007045 1:230058368-230058390 ACGGGGGCTTAGGGGATCCTGGG - Intronic
923291795 1:232552957-232552979 ACTGGGGCTTTGGGAGTCGCAGG - Intronic
924144078 1:241055825-241055847 ACTGGTGGCTGGGGGCTCCTGGG - Intronic
924902722 1:248418589-248418611 TCTGGGGCTTTGGGGGTCACAGG + Intergenic
1062915938 10:1241384-1241406 AATGGGACCTTGGGGGGCTTTGG - Intronic
1063134126 10:3201655-3201677 ACTGGGGACCGTGGGGTCCTGGG + Intergenic
1063141033 10:3256792-3256814 CCTGGGGCCTTGGAGGCACTCGG + Intergenic
1063251784 10:4282007-4282029 AATGTGGACTTGGGGGTCCTGGG - Intergenic
1063400780 10:5743274-5743296 ACCGGGGACTTGGAGGTCCTTGG + Intronic
1065529346 10:26653108-26653130 CTTGGGGCCTTGGGGGGCCGGGG - Intergenic
1066746362 10:38605983-38606005 GCAGGGGCCTTGGGGGAACTGGG + Intergenic
1067319786 10:45206425-45206447 ACTGGGGCCTGGGAGTTCGTGGG + Intergenic
1067689191 10:48490449-48490471 ACTGGGGCATTTGGGCTCCAAGG - Intronic
1067936769 10:50619529-50619551 AGAGGGGCCTGGGGGGTGCTGGG + Intronic
1070476808 10:76836807-76836829 CCTGGGGACTTGGGGCTCTTCGG + Intergenic
1070770493 10:79079631-79079653 ACTGGGGCCGGGGGGGTCCAGGG + Intronic
1071490158 10:86130839-86130861 ACTGGGGCTTTGGGAGTCACAGG + Intronic
1072050727 10:91700563-91700585 ACTGGGGCCGTGGCCTTCCTCGG - Intergenic
1072359755 10:94647874-94647896 ACTGGGGGCTGGGGGGTGCTGGG + Intergenic
1072443874 10:95481079-95481101 ACAGGGGCCCCGGGGGTGCTTGG - Intronic
1073124292 10:101140178-101140200 GCTGGGGCCTGGGGCGTCCGGGG + Intergenic
1074676297 10:115855080-115855102 ACTGGCTACATGGGGGTCCTTGG + Intronic
1076685494 10:132196763-132196785 ACTGGAGGGTTGGGGGTCTTGGG - Intronic
1077192503 11:1261297-1261319 ACATGGGCCTCTGGGGTCCTGGG - Intronic
1077227119 11:1443269-1443291 GCGGGGGCCTTGGAGGGCCTGGG - Intronic
1077228240 11:1447567-1447589 ACTGGGGACGCAGGGGTCCTGGG + Intronic
1077442408 11:2574858-2574880 ACTGGGGCCTTCGGGGACACAGG - Intronic
1077453736 11:2665727-2665749 CCTGGGGCTTTGGGGGTTCTGGG - Intronic
1077722108 11:4639562-4639584 ACTGGGGCCTTGGAGGGTCAGGG + Intergenic
1078842504 11:15091872-15091894 CCTGGGGCCTTGAGTGTTCTAGG + Intergenic
1079136062 11:17776637-17776659 AGTGGGGGCCTGGGGGCCCTGGG + Intronic
1080604354 11:33852606-33852628 TCTGGGGCTTTGGGGGTCACAGG - Intergenic
1080823244 11:35826729-35826751 AGTGGGGGCTTAGGGGTCCTGGG - Intergenic
1081776885 11:45681743-45681765 AAGGGGGCCATGGGGGTGCTGGG + Intergenic
1083345822 11:61991247-61991269 ACTGGGGCCTGTGGGGTGCAGGG + Intergenic
1083743409 11:64722783-64722805 GCTGGGGGCTTGGGGGTCGGAGG - Intronic
1083940698 11:65893947-65893969 ACTGGGGCTCTGGGGGCTCTGGG + Intronic
1083961009 11:66015136-66015158 ATATGGGCCTTGGGGGTGCTAGG + Intergenic
1084411656 11:69009439-69009461 CATGGAGCCTAGGGGGTCCTGGG - Intronic
1085694506 11:78692514-78692536 CCTGGGGTCCTGGGGGCCCTGGG - Intronic
1087221100 11:95547156-95547178 ACTGGGGCCTGGGTAGTCCCAGG - Intergenic
1087608382 11:100405120-100405142 TCTGGGGCTTTGAGGGTCGTGGG - Intergenic
1088978053 11:114833254-114833276 ACTGAGGCCTGGGAGGTCCAGGG - Intergenic
1089031011 11:115329598-115329620 ACTGGGGCTTTGGGAGTCACGGG - Intronic
1089537324 11:119168838-119168860 ACTCGGGCCTGCGGGGTCCTGGG - Exonic
1089561722 11:119346555-119346577 AGTGGGCCCTTGGGGGTCTTGGG - Exonic
1089613686 11:119683552-119683574 ACAGGGGCTTTGGGGATCCCGGG + Intronic
1091825833 12:3511998-3512020 ACTGGGGCCTTGGGAGTGTGGGG + Intronic
1093326460 12:17781295-17781317 ACTGGAGGCTCTGGGGTCCTTGG + Intergenic
1094666601 12:32526421-32526443 AGTGGGGCCTTGGAGAACCTGGG + Intronic
1094870266 12:34595744-34595766 CCCTGGGCCTTGGGGATCCTGGG + Intergenic
1095981444 12:47976902-47976924 TCTGGGGCCTTGAGGACCCTGGG + Exonic
1095985663 12:47997810-47997832 GGTGGGGCCTTGGGGGACCTGGG + Intronic
1096587346 12:52631434-52631456 CCTGGGGTCTTGCTGGTCCTGGG - Intergenic
1096604286 12:52753799-52753821 CCTGGGGCTTTGGGGGTTCGGGG - Intergenic
1097267024 12:57752045-57752067 AGTGGGGCCTTTGTGGTCATGGG - Intronic
1097841201 12:64323203-64323225 ACTGGGGGCTTGAGTGTCCCAGG - Intronic
1102543919 12:113641306-113641328 GCTGGTGCCTTGGGTCTCCTGGG + Intergenic
1102677044 12:114665994-114666016 ACTGGGGCTTTGGGTGTCTGAGG - Intergenic
1103322862 12:120101952-120101974 AGTGGGGCCTGGGGGGTCCGAGG - Intronic
1103680547 12:122690279-122690301 GCTTGGGCCCAGGGGGTCCTGGG - Intergenic
1103933349 12:124462342-124462364 ACTGGGGGCTTGGGGCTTCTTGG - Intronic
1104084077 12:125458494-125458516 AGTGGGGCCTTGCAGGTCCTGGG + Intronic
1104286690 12:127430748-127430770 AGTGGGGCCTTGCAGGTCCTGGG - Intergenic
1104551776 12:129763740-129763762 CCTGCAGCCTTGGGGGTCCATGG - Intronic
1104554833 12:129790205-129790227 ACTGGGGCTTCAGGGGTCGTGGG - Intronic
1104932845 12:132348896-132348918 TCTGAGGCCTGGGGAGTCCTGGG - Intergenic
1106482257 13:30145714-30145736 ACGGGGGCCGTGGGGGGTCTGGG + Intergenic
1107559571 13:41547357-41547379 ACTGCAGCCGTGGGGGCCCTGGG - Intergenic
1108104811 13:46997625-46997647 ACTGGGGCTTTGGGAGTCACAGG - Intergenic
1112468534 13:99667138-99667160 TGTGGGGCTTTGGGGGTCTTGGG + Intronic
1112933477 13:104770291-104770313 ACTGGGGCCTTAGTGGTCTTGGG - Intergenic
1113430849 13:110249033-110249055 TCTTGGGCCCTGGGGGTCCATGG - Intronic
1113695965 13:112345695-112345717 ACTGCAGCCTTGGGGGTCCCAGG - Intergenic
1113830297 13:113290526-113290548 GCTGGGGCCATGGGGGTTCCAGG - Intergenic
1114652217 14:24292432-24292454 GCTGAGACCTTGGGGCTCCTGGG - Intronic
1118882906 14:69843763-69843785 GCTGGGCCCTCGGGAGTCCTAGG + Intergenic
1121315881 14:92960759-92960781 ACTGGGGCTGAGGGGGGCCTGGG + Intronic
1121403502 14:93703401-93703423 GCTGGGTCTTTGGGGTTCCTTGG + Intronic
1122410141 14:101521608-101521630 GCTGGGGCCATGGGGGTCTGGGG - Intergenic
1122599548 14:102914565-102914587 CCTGGGGCCTGGGGGTCCCTGGG - Intergenic
1122643375 14:103175625-103175647 TCTGGGGCTTTGGGCGTCATGGG + Intergenic
1122984348 14:105205411-105205433 CCAGGGTCCTTGGGGTTCCTTGG + Intergenic
1124417095 15:29481049-29481071 AGTGCTGCCTTGGGGGTCCATGG + Intronic
1125676295 15:41504127-41504149 CCTGGGGCTGTGGGGGTCTTAGG + Exonic
1126429049 15:48561080-48561102 ACTGGGGTTTTGGGTGACCTTGG - Intronic
1128669477 15:69563642-69563664 ACCGGGGCCATAGGGGTTCTTGG - Intergenic
1129478349 15:75803041-75803063 CGTGGGGCCTTGTGTGTCCTGGG + Intergenic
1129894458 15:79092974-79092996 ACTGAGTCCTTGGGGTCCCTAGG - Intergenic
1129960025 15:79675753-79675775 TCTGGGGCCTTGAGGGAACTGGG - Intergenic
1131019859 15:89088702-89088724 TCTGGCGCCGTGGGGGTCCCAGG + Intronic
1131990625 15:98089359-98089381 GCTGAGGCCTTTGGGTTCCTAGG - Intergenic
1132099507 15:99013914-99013936 GCTGAGGCCTTTGGGTTCCTAGG + Intergenic
1132672044 16:1106027-1106049 GCTGGGGCCGTGGGGGGCCTCGG + Intergenic
1132767569 16:1542145-1542167 CCTGAGGCCTTGGGTGGCCTGGG + Intronic
1132997150 16:2829356-2829378 CCTGGGTCCTTCAGGGTCCTTGG + Intergenic
1133030182 16:3007057-3007079 CCTGGGGCCCTGGGTGCCCTTGG + Intergenic
1133280744 16:4663821-4663843 GCTGGGGCCCTGGGGGCCGTGGG + Intronic
1133684340 16:8151471-8151493 ACTGGGGCCTTTTGGATGCTGGG - Intergenic
1134245007 16:12533324-12533346 CCTGTGGCCCTGTGGGTCCTGGG + Intronic
1134608840 16:15591886-15591908 AGTGGGGGCTTGGGGGTTCCGGG + Intronic
1135392371 16:22104601-22104623 ACTGCAGCCTTGAGGCTCCTGGG - Intronic
1136032886 16:27516324-27516346 ATGGGTGCCTTGTGGGTCCTGGG - Intronic
1136068668 16:27775353-27775375 CCTGAGGGCTTGGGCGTCCTGGG + Intronic
1136584421 16:31174778-31174800 ACTGGGGCCTTGGGGGTCCTGGG - Intergenic
1136682748 16:31977528-31977550 TCTGGGGTCTTGAGGGTCCCTGG + Intergenic
1136783386 16:32921094-32921116 TCTGGGGTCTTGAGGGTCCCTGG + Intergenic
1136886401 16:33932755-33932777 TCTGGGGTCTTGGGGGTCCCTGG - Intergenic
1137712211 16:50574320-50574342 ACTGGGGGCTGAGGTGTCCTGGG + Intronic
1137726752 16:50661926-50661948 GCTGGGGCCCTGGGGGACCCTGG + Intergenic
1138507503 16:57485717-57485739 TCTAGGGCCTTGCGGGCCCTGGG + Intronic
1138657158 16:58498160-58498182 GGTGGGGCCTTGGGGGACATGGG + Intronic
1138733392 16:59221610-59221632 ACTGGGGCCTGGAGGTTGCTTGG + Intergenic
1140157334 16:72445296-72445318 ACTGGGGCCTGTTGGGTGCTGGG - Intergenic
1140514213 16:75530457-75530479 ACTGAGACCTTGGGAGTCTTGGG - Exonic
1141929788 16:87194385-87194407 ACTGAGGCCTGCAGGGTCCTGGG + Intronic
1142210065 16:88804554-88804576 TCTGGGGCCTCGGGGGTACTGGG - Exonic
1142252021 16:88996397-88996419 ACTGCAGCCTTGGAGGTCCCTGG + Intergenic
1142351890 16:89584374-89584396 ACAGTGGCCTCGGGGGTGCTGGG - Intronic
1203086037 16_KI270728v1_random:1185078-1185100 TCTGGGGTCTTGAGGGTCCCTGG + Intergenic
1143372302 17:6447841-6447863 ACTGGGCCCTAGGGGTTTCTTGG + Intronic
1144178489 17:12731004-12731026 ACTGGCCCCTTGGGGATCTTGGG - Intronic
1144945113 17:18965813-18965835 CCTGGGGCCTGTGAGGTCCTGGG - Intronic
1146242842 17:31245949-31245971 ACTGGTGGCTGGGAGGTCCTAGG - Intronic
1146901461 17:36592058-36592080 ACGGGGGCCTCGGGGGGCATCGG + Exonic
1147143654 17:38473287-38473309 TCTGGGGTCTTGGGGGTCCCTGG + Intronic
1147539725 17:41347007-41347029 TCCGGGGCCCTGGGGGGCCTCGG + Intronic
1147541674 17:41365338-41365360 TCCGGGGCCCTGGGGGGCCTCGG + Intronic
1147545148 17:41395408-41395430 TCCGGGGCCCTGGGGGGCCTTGG + Intronic
1147980866 17:44273064-44273086 GCTGGGCCCTGGGGAGTCCTGGG + Intergenic
1148031911 17:44627756-44627778 ACTGGGGCCTGGGGTGTTCCAGG - Intergenic
1148063221 17:44850726-44850748 AATGGGGCCTTGGCGCTCATGGG + Exonic
1148796801 17:50200971-50200993 GCTGGGGCCGTGGGGGTGCTGGG - Intronic
1149102907 17:52927801-52927823 ACGTGGGCTTTGGGGGTCATGGG - Intergenic
1149646433 17:58244847-58244869 ACTGGTGCCCTGTGGGCCCTGGG - Intronic
1150288173 17:63965823-63965845 CATGAGGCCTAGGGGGTCCTGGG + Intronic
1150648456 17:66994537-66994559 ACTGGGCCCCTGGGGGGCCAGGG - Intronic
1151477142 17:74350588-74350610 GGTGGGGCCTGGAGGGTCCTGGG - Intronic
1152066883 17:78117046-78117068 AGTGGGGCCCTGCGGGTCCTTGG + Intronic
1152634059 17:81423271-81423293 GAAGGGGCCTTGGGGGCCCTGGG + Intronic
1152738134 17:82007456-82007478 GCTGTGGGCCTGGGGGTCCTTGG + Intronic
1152987725 18:335025-335047 ACGGGAGCCTTTGGGGCCCTGGG + Exonic
1154308945 18:13253001-13253023 ACCGGGGCACTGGGGGTCCAGGG + Intronic
1154416814 18:14179662-14179684 ACGGGGGCCTTGGAGGTCGCCGG + Intergenic
1156905662 18:42349009-42349031 TGTGGGGCCTTGGGGGTCACAGG + Intergenic
1158223868 18:55180342-55180364 TCTGGTGCCTTGGGGATCCTTGG - Intergenic
1158559889 18:58505007-58505029 AGTCAGGCCTTGGGGGACCTGGG + Intronic
1160375116 18:78405847-78405869 ACTGGAGCCCTGTGGGACCTGGG - Intergenic
1160431820 18:78818277-78818299 GCTGGGGCCTTGGAGTCCCTGGG + Intergenic
1160431829 18:78818301-78818323 GCTGGGGCCTTGGAGTCCCTGGG + Intergenic
1160873542 19:1287275-1287297 GCCGGGGCTTTGGGGGTCCTGGG + Intronic
1161167090 19:2793963-2793985 ACTGGAGTCTTGGGGGTCATGGG + Intronic
1161473454 19:4472594-4472616 CCTGGGGGTCTGGGGGTCCTGGG + Intronic
1161473502 19:4472712-4472734 CCTCGGGGCCTGGGGGTCCTGGG + Intronic
1161597183 19:5156515-5156537 TCTGGGGCCCTGGGAGTCCCTGG - Intergenic
1161942699 19:7415549-7415571 CCATGGGCCTTGGGGGCCCTTGG - Intronic
1162472963 19:10883334-10883356 ACTGGGGACGAGGGGGTCTTGGG - Intronic
1162502098 19:11059928-11059950 GCTGGGGCCTTGGGGGCTCTCGG - Intronic
1163282841 19:16327561-16327583 ACTGGGGCCTTGGGGCACTTGGG + Exonic
1163414567 19:17178214-17178236 AGTGGGGCCATGGGGGCACTTGG + Intronic
1164818394 19:31224951-31224973 ACAGGGGCCCTGGGGCTTCTAGG - Intergenic
1165453925 19:35900146-35900168 TCTGGGTCCTTGGAGGTGCTAGG - Intronic
1166365029 19:42273947-42273969 CCAGGGGCCTTGGGGGCCCCTGG + Intronic
1166420194 19:42630690-42630712 AGTGGGGATTTGGGGGTCCTGGG - Intronic
1167265594 19:48481446-48481468 GCTGGGAGCTTGGGGGTCCTGGG - Intronic
1167642764 19:50690888-50690910 AGGGGAGCCATGGGGGTCCTGGG - Intronic
1168094478 19:54106856-54106878 GCTGGGGCCCTGAGGGTCCTGGG - Exonic
925014321 2:510309-510331 CCTGCGGTCTTGGGGTTCCTGGG + Intergenic
925194905 2:1914946-1914968 ACGGCGGCCTTGGGGGCCCTGGG + Intronic
925310495 2:2878287-2878309 TCTGGGGCTTTGGGGGTCACAGG - Intergenic
925845564 2:8030254-8030276 ACTGGGTCCTTGGTGTTCCTGGG + Intergenic
925919566 2:8629589-8629611 ACTGGTGGCCTGGAGGTCCTGGG - Intergenic
927698266 2:25251984-25252006 AGTGGGGCCTTGGGGCTCGTGGG + Intronic
928024139 2:27726305-27726327 ACTGTGGCCAAGGGGCTCCTAGG + Intergenic
929569169 2:43009240-43009262 GCTGGGGACTGGGGGGACCTTGG + Intergenic
930533249 2:52615691-52615713 ACTGGGGCTCTGGGGGTTGTGGG + Intergenic
931452387 2:62379163-62379185 AATGGGGGCTTGGGGCTTCTGGG + Intergenic
931567300 2:63628003-63628025 TCTGGGGCTTTAGGGGTCATGGG + Intronic
932114816 2:69036841-69036863 GCTCTGGCCCTGGGGGTCCTGGG - Intronic
932837927 2:75054660-75054682 CTTGGGGGTTTGGGGGTCCTTGG + Intronic
933524398 2:83416930-83416952 ACTGGGCCCTTGAGGGCCCTGGG + Intergenic
934845826 2:97660787-97660809 ACTGGGGCCTATGGGGTTCGGGG + Intronic
935115829 2:100135540-100135562 TCTGGTGCCTTGGAGCTCCTTGG - Intronic
935662292 2:105477485-105477507 ACTGGGGCCTTCTGGAGCCTTGG + Intergenic
938699488 2:133863372-133863394 GCTGGGGCTTTGGGAGTCGTAGG - Intergenic
940907575 2:159183102-159183124 AGTGGGGACTTGGGGGGACTGGG + Intronic
941853895 2:170211159-170211181 CCTGGGGCCATGGGACTCCTTGG - Intronic
941930645 2:170935548-170935570 GGTGGGGCGTTGGGGGTGCTGGG - Intronic
945868571 2:215203025-215203047 TCTGGGGCTTTGGGGGTTGTGGG - Intergenic
946400447 2:219465650-219465672 ACTGGTTCCTCGGGGTTCCTGGG - Intronic
948016194 2:234692736-234692758 ACTGGGTCCTGGGGGGTCAATGG + Intergenic
948464254 2:238144730-238144752 ACGGGGGCCCGGGGGGTCCTGGG - Intronic
948468351 2:238162770-238162792 GATGGGGCCTGGGGGGCCCTGGG - Exonic
948847202 2:240688730-240688752 ACTGGAACCTTGGGGAGCCTTGG + Intergenic
1169081544 20:2800457-2800479 CCTGGGACCTTGGTGGTCCCGGG + Exonic
1169440169 20:5627197-5627219 TCTGGGGCCTTGGGGGTCGTGGG + Intergenic
1169475447 20:5927001-5927023 ATAGGGGGCTTGGGGTTCCTGGG + Intergenic
1172168925 20:32917211-32917233 ACTGGAGCCTTGAGGATTCTGGG - Intronic
1172765588 20:37349034-37349056 GCTGGGGCCTTGTGGGCCCTGGG + Intronic
1172878336 20:38180182-38180204 GCTGGGGTTTTGGGGGTACTTGG + Intergenic
1173551369 20:43935084-43935106 ACTGGTGCCTTGGGGGTGAATGG + Intronic
1173556972 20:43973215-43973237 AATGGGGCTTTGGGCATCCTGGG + Intronic
1173757261 20:45527933-45527955 ACTGTAGCCTAGGGGCTCCTGGG + Intergenic
1174424654 20:50423477-50423499 TGTGGGGCCTTGGGGGTCACGGG - Intergenic
1174452904 20:50630789-50630811 ACAGGGGCCGTGGGGGTCGTGGG - Exonic
1175074890 20:56363901-56363923 GCTGTGGCCTTGGAGGGCCTGGG + Intronic
1175424187 20:58853861-58853883 CCTGAGGGCTTGGGGCTCCTCGG - Exonic
1175683657 20:61010146-61010168 CCTGGGGCTTGGGGGCTCCTTGG + Intergenic
1175831435 20:61967115-61967137 ACTGGAGCCCTGGTGGTCCCTGG - Intronic
1176071193 20:63227252-63227274 GGTGGGGCCTTACGGGTCCTGGG + Intergenic
1176413259 21:6460116-6460138 CCGTGGGCCTGGGGGGTCCTGGG - Intergenic
1176856525 21:13979615-13979637 ACGGGGGCCTTGGAGGTCGCCGG - Intergenic
1176868069 21:14064592-14064614 ACGGGGGCCTTGGAGGTCGCCGG + Intergenic
1179202372 21:39236476-39236498 AGTGGTGCCTTGGGTGTCTTGGG - Intronic
1179569534 21:42269856-42269878 ACAGGGACCTGTGGGGTCCTTGG - Intronic
1179572731 21:42287391-42287413 CCTGGGGACTTGGAGGTCCTGGG - Intronic
1179616575 21:42587071-42587093 GCTGGGGCCTTGGCTGCCCTTGG + Intergenic
1179688756 21:43068438-43068460 CCGTGGGCCTGGGGGGTCCTGGG - Intronic
1179780217 21:43694763-43694785 GCTGGGACCTTGGAGATCCTGGG - Exonic
1179818654 21:43923744-43923766 AGTGAGGCCTGGGGGATCCTGGG + Intronic
1179912065 21:44455725-44455747 GCTGGGGTCTCGGGGGTCCCAGG + Intronic
1180085217 21:45505232-45505254 AAGGGGGCCCTGGGGGGCCTGGG - Exonic
1180088037 21:45516829-45516851 GCTGGGGCCTCAGGGGTCTTGGG - Intronic
1180092901 21:45542037-45542059 CCTGGGGTCTGGGGGGCCCTGGG - Intronic
1180092926 21:45542097-45542119 CCTGGGGTCTGGGGGGCCCTGGG - Intronic
1180703422 22:17794221-17794243 ACCGGGGCCTTTGGGGCCTTGGG + Intronic
1180853744 22:19033978-19034000 ACTGGGGCCTTTGGGGTGGGGGG + Intergenic
1181006126 22:20014570-20014592 AGCTGGGCCTTGGGGGTCCTGGG - Intronic
1181860157 22:25812107-25812129 ACTGTGTCATTGGGGGTCCAAGG + Intronic
1181945127 22:26510685-26510707 TCTGGATCCTTGGTGGTCCTAGG + Exonic
1182097828 22:27638033-27638055 ACTGGGGACTTGGGGCTCCGTGG - Intergenic
1182299844 22:29331268-29331290 ACTAAGGCCGGGGGGGTCCTGGG + Intronic
1182312086 22:29416364-29416386 AGGGGGGCATAGGGGGTCCTAGG + Intronic
1182688174 22:32136879-32136901 AGGGGGGCATAGGGGGTCCTAGG - Intergenic
1182695769 22:32198488-32198510 AGGGGGGCGTAGGGGGTCCTAGG + Intronic
1183791410 22:40073490-40073512 ATTGGGGTTTTGGGGGTGCTGGG + Intronic
1184094520 22:42309398-42309420 ACTGGGGCCTGGCGGGGTCTGGG - Intronic
1184099410 22:42334143-42334165 CCTGGGACCTTGGGTGGCCTTGG + Intronic
1184124581 22:42478123-42478145 GCAAGGTCCTTGGGGGTCCTAGG - Intergenic
1184289001 22:43488243-43488265 GCTGGGGCCTTGGGGGGCCCTGG - Intronic
1184654863 22:45935936-45935958 ACTTGGGTCTCGGGGGGCCTAGG + Intronic
1184669724 22:46006410-46006432 CCTGGGGCCATGGGTGTCGTAGG - Intergenic
1184930392 22:47676941-47676963 TCTGGAGGCTTGGGGGTCCAGGG - Intergenic
1185288508 22:50012936-50012958 CTTGGGGCCTTTGGGGTCCGAGG + Intergenic
1185398031 22:50602401-50602423 ACTGGGGGCTTCTGGGTGCTGGG + Intronic
949943272 3:9171107-9171129 GCTGGGGCCTCAGGGGTTCTTGG - Intronic
950086191 3:10259695-10259717 ACTGGGGGATTGGAGTTCCTGGG + Intronic
950541373 3:13615226-13615248 ACATGGGCCTTGGTGGCCCTGGG + Intronic
952326033 3:32321485-32321507 AATGGAGTCTGGGGGGTCCTAGG - Intronic
953758175 3:45665769-45665791 GCAGGGGCCTGGGGGGACCTGGG + Intronic
954382925 3:50229217-50229239 CCAGGGTCCTTGGGGGGCCTGGG - Intronic
954643498 3:52116430-52116452 ACTGAGGCTCTGGGGATCCTGGG + Intronic
955252023 3:57293086-57293108 ACTGTGGCCTTCAGTGTCCTTGG + Intergenic
957216404 3:77325473-77325495 TCTGGTGCCATGGGGGCCCTGGG + Intronic
958100262 3:88999645-88999667 TCTGGGGCTTTGTGGGTCATGGG + Intergenic
959046165 3:101476254-101476276 ACTGGGGCCTTTGGGGGATTGGG - Intronic
959450165 3:106488834-106488856 ACTGGGGCACTGGGCGACCTGGG - Intergenic
959573414 3:107909395-107909417 AGTGGGGCCTTGTGAGTCATGGG + Intergenic
959755253 3:109889607-109889629 ACTAGGGCTTTGGGCGTCCAAGG - Intergenic
960166769 3:114411300-114411322 CCTGGAGCCATGGGGGACCTGGG - Intronic
960873210 3:122271754-122271776 ACTGGGGCTTTGGGGGCCTAGGG - Intronic
960937490 3:122912743-122912765 ACCTGGGCATTGGGGTTCCTGGG + Intronic
961381513 3:126498956-126498978 GCTGTGGCCCTGGGGGTCGTGGG - Intronic
962748036 3:138412018-138412040 GCTGGGGACTTGGGGGTCACAGG + Intergenic
966182003 3:177196973-177196995 ACTTGGCCCTTGGGGGAACTGGG - Intronic
967969580 3:194989062-194989084 ACAGAGGCCTTCTGGGTCCTCGG - Intergenic
968392677 4:205780-205802 AGTGGGGTCCTGGGGGTCCTGGG - Intergenic
968519887 4:1030450-1030472 GGTGGGGCCTGGCGGGTCCTGGG + Intergenic
969055279 4:4397718-4397740 CCTCGAGGCTTGGGGGTCCTGGG - Intronic
969611327 4:8229179-8229201 AATGGGGCTTGTGGGGTCCTTGG + Intronic
969637060 4:8375379-8375401 ACTGAGGCCTTGGAGGGCGTCGG - Intronic
971231029 4:24800268-24800290 AGGGGGGCCTCGGGGGTCCCTGG - Exonic
972620602 4:40744895-40744917 ACTGTGGCCTCGGGACTCCTGGG + Intergenic
972632771 4:40856745-40856767 ACTGGCGAATTGGGGGTCCAAGG + Intronic
976230064 4:82833391-82833413 ACTGGGGCCTGTGGGGGGCTAGG + Intronic
976883558 4:89960203-89960225 TCTGGGGCTTTGGGGGTTGTGGG - Intergenic
979418482 4:120474072-120474094 ATAGGCGCTTTGGGGGTCCTTGG + Intergenic
981201664 4:141987253-141987275 ACTGGGGCCTTTTGGGGGCTGGG - Intergenic
981479023 4:145217423-145217445 ACTGGGGCTTGGGGGGTCAAGGG + Intergenic
982198581 4:152938004-152938026 AATTCGGCCTGGGGGGTCCTGGG - Intronic
982341482 4:154303626-154303648 ACTGGGTCCTTGGGGCTGTTAGG + Intronic
982671011 4:158320167-158320189 TCTGGGGCTTTGGGGGTCTTGGG - Intronic
982918426 4:161244407-161244429 ACTGGGGCTTTGGGAGTCATAGG - Intergenic
983561814 4:169109193-169109215 ACTGGACCTTTGGGGGTCCGTGG - Intronic
984098020 4:175455277-175455299 TCTGGGGCTCTGGGGGTCCTGGG - Intergenic
984300529 4:177911858-177911880 TCTGGGGCTTCGGGGGTCATAGG - Intronic
984585995 4:181564993-181565015 TCTGGGGATTTGGAGGTCCTCGG - Intergenic
985614460 5:911070-911092 GCTGGGTCCTTGGGGGACATTGG + Intronic
985685173 5:1278054-1278076 ACTGGGGTCCTGGGGGTGCCAGG + Intronic
986646529 5:9921576-9921598 ACTGCAGACTTGGAGGTCCTGGG + Intergenic
988350950 5:30106624-30106646 TCTGGGGCTTCGGGGGTCGTGGG + Intergenic
988689437 5:33557709-33557731 ACTGGGGGATTGGGGATCCCTGG - Intronic
994591958 5:101784481-101784503 ACCTGTGCCTTGGTGGTCCTGGG + Intergenic
996706243 5:126501615-126501637 TCTGGGGCTTTGGGGGTCACAGG - Intergenic
999295586 5:150457783-150457805 ACTGTGGCCCAGGTGGTCCTGGG + Intergenic
1000757342 5:165177828-165177850 ACAGTGGACTTGGGGGACCTGGG - Intergenic
1001254886 5:170175874-170175896 ACTGTGGCCTTAGGGGGCATAGG + Intergenic
1001407518 5:171486338-171486360 ACTGTGGCCTTGGGGACTCTTGG - Intergenic
1001537540 5:172508709-172508731 CCAGGGGCCTTGGGGATCTTGGG + Intergenic
1002423733 5:179163960-179163982 ACTGGGGCCAGGGGAGCCCTGGG + Intronic
1003263900 6:4549767-4549789 ACTGGGGCTTGCGGGGTCCCCGG + Intergenic
1006292143 6:33146424-33146446 ACTAGGGCCTTTGGGGGCTTTGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006514407 6:34538083-34538105 TCTGGGGCCTTCGGGACCCTGGG - Exonic
1006812674 6:36830231-36830253 GATGGGGCTTTGGGAGTCCTTGG - Intronic
1009610295 6:65931609-65931631 TCTGTGCCCTTGGGGGTCCAGGG - Intergenic
1011491790 6:87900545-87900567 ACTGGGGCTTTGGGAGTCACAGG - Intergenic
1013847554 6:114472119-114472141 ACTGGGGCCTTGGGGGTGATGGG - Intergenic
1014386162 6:120804965-120804987 ACTGGGGCCTTGGAGGGGGTGGG + Intergenic
1017003038 6:150008890-150008912 ACAGGGGTCATGGGGGTTCTTGG + Intergenic
1017889349 6:158626064-158626086 ACTGGGGACCTCGGGATCCTTGG + Intronic
1018779099 6:167045950-167045972 ACTGGGGCAGTAGGGGTGCTGGG - Exonic
1019415863 7:926273-926295 GCTGAGGCCTTGGGGGTCTCGGG - Intronic
1019434075 7:1012763-1012785 CCAGGGGCCTTGGGGGTGCCCGG + Intronic
1021083015 7:16385937-16385959 ACTGGGGCTTTAGGAGTCATGGG - Intronic
1022516534 7:30978269-30978291 CCATGGGCCCTGGGGGTCCTGGG + Intronic
1023025869 7:36049198-36049220 CCTGGGGCCTTAAGTGTCCTAGG + Intergenic
1023346806 7:39279043-39279065 ACTGGGGCCATGGTGCACCTGGG - Intronic
1023821711 7:43984286-43984308 ACTGTGGCCTTGTGGGTTCAGGG + Intergenic
1023841553 7:44101279-44101301 GCTGCTGCCATGGGGGTCCTGGG + Intergenic
1023866647 7:44241614-44241636 AGGGGGGCCTTGGGGGGTCTGGG - Intronic
1024862508 7:53861964-53861986 TCTGGGGCTTTGGGGGCCATGGG - Intergenic
1025191501 7:56899089-56899111 GCTGGGGACTTGGGGTTCTTGGG - Intergenic
1025680448 7:63677845-63677867 GCTGGGGACTTGGGGTTCTTGGG + Intergenic
1026281057 7:68922052-68922074 TCTGGGGCTTTGGGAGTCGTGGG + Intergenic
1028288214 7:89031006-89031028 ACTGGGGCCTTTTGGGGGCTGGG + Intronic
1028605348 7:92649486-92649508 ATTGGGGCATTCGGGCTCCTTGG - Intronic
1029207601 7:98878755-98878777 GCTGGGGCCTAGGGGATCCCGGG - Intronic
1029363117 7:100101173-100101195 GCTGGGGTCTTGGGGGACCGGGG - Intronic
1029420075 7:100467760-100467782 ACCGGGGCCTGGGAGGCCCTGGG - Intronic
1029749973 7:102537705-102537727 ACTGTGGCCTTGTGGGTTCAGGG + Intergenic
1029767923 7:102636811-102636833 ACTGTGGCCTTGTGGGTTCAGGG + Intronic
1030075406 7:105732552-105732574 GGAGGGGCCTTGGGGGTCCATGG - Intronic
1030098791 7:105926099-105926121 ACTGGGGCCTTTGGAGATCTGGG + Intronic
1033206463 7:139427238-139427260 AGTGGGGCCTTGGGGGCTCTAGG + Intergenic
1033968366 7:147006798-147006820 ACTGGGGAGTATGGGGTCCTTGG + Intronic
1034232170 7:149539034-149539056 ACTGATGGCTGGGGGGTCCTGGG - Intergenic
1035731121 8:1854145-1854167 CCTGGGCCCTGGGGGATCCTGGG - Intronic
1035760007 8:2062117-2062139 AGAGGTGCATTGGGGGTCCTGGG + Intronic
1035824636 8:2631384-2631406 ACTGGGGCTTTGGGAGTCACAGG - Intergenic
1036645399 8:10609071-10609093 ATTGTGGCCTTGGGGGACATAGG + Exonic
1036647906 8:10623557-10623579 ACTGGGGACATGGAGGTGCTGGG - Intronic
1037778184 8:21849376-21849398 ACTGTGGCTGTGGGGGTCCCGGG - Intergenic
1037841078 8:22245510-22245532 ACTGGGGCCCGGGGGCTCATCGG + Exonic
1039377669 8:37052481-37052503 ACATGGGCCTTTGGGGACCTTGG - Intergenic
1042909925 8:73816272-73816294 ACTGAAGCCTTGGGGGTCAAGGG - Intronic
1044870850 8:96618509-96618531 ACCAGGGCCTTGGGGGATCTGGG + Intergenic
1045754933 8:105531371-105531393 ACAGGGGCCTTGGGGTTCCTTGG + Intronic
1045860697 8:106812254-106812276 ATTGAGGGCTTCGGGGTCCTGGG - Intergenic
1046465969 8:114603900-114603922 ACTGTAGCCTTGGGCCTCCTGGG + Intergenic
1046606536 8:116377588-116377610 ACTGGAACCCTGGGGGTCTTTGG + Intergenic
1048800450 8:138189560-138189582 TCTGGGACTTTGGGGGTCATGGG + Intronic
1048879562 8:138861192-138861214 ACAGGGGCCTCAGGGGTCCTGGG + Intronic
1050863821 9:10471340-10471362 ATTGGGGGTTTGGGGGTCATGGG + Intronic
1051414905 9:16829060-16829082 CCTGGGGCCTGGGGCGGCCTGGG + Intronic
1053102851 9:35385825-35385847 ACTGGGGCTTGGGTGGTGCTGGG + Intronic
1055486319 9:76759814-76759836 ACTGGGGCTTTGGGAGTCACAGG + Intronic
1056622392 9:88225204-88225226 CCTGGGCCCTGGTGGGTCCTTGG - Intergenic
1057726727 9:97573238-97573260 CCTGGTGCCCTGGGGGTCCTGGG - Intronic
1059456260 9:114402196-114402218 GCTGGGGCCTTGGGGTCCCCAGG + Exonic
1061328598 9:129878809-129878831 ACTGGGGACTTGGGGGACCCTGG - Intronic
1061674133 9:132206169-132206191 ACTGGGGCCTATGGGCTCTTAGG + Intronic
1061711775 9:132492955-132492977 GCTGGAGCCGTGGGAGTCCTCGG - Intronic
1062027780 9:134348467-134348489 ACATGGGCCCTGGGGGACCTCGG - Intronic
1062099621 9:134721358-134721380 ACGGGGTCATGGGGGGTCCTGGG - Intronic
1062118922 9:134823448-134823470 CCGGGGGGCCTGGGGGTCCTGGG - Exonic
1062612601 9:137381818-137381840 ATGGGGTCCTTGGGGGTCCTGGG - Intronic
1186690669 X:11971988-11972010 ACTGTGGCCCTGGGAGTCCCTGG + Intergenic
1188482957 X:30653321-30653343 CCTGGAGCCTTGGGGGTACGCGG + Intergenic
1189244886 X:39555669-39555691 GATGGGGCCTTTGGTGTCCTGGG + Intergenic
1190107481 X:47570520-47570542 TCTGGGGCCTAGAGGGTTCTAGG - Intronic
1190309512 X:49106816-49106838 ACTGAGGCCTGGGGAGGCCTGGG + Intergenic
1190333165 X:49248053-49248075 ACAGGGGATTAGGGGGTCCTCGG + Intronic
1191251026 X:58260277-58260299 ACCAGGCCCTTGGGGGTCTTGGG + Intergenic
1191252340 X:58265584-58265606 GCGGGGGTCTTGGGGGTCCCTGG - Intergenic
1192108054 X:68335265-68335287 ACTGTGGGCTTTGGGGTCCGAGG - Intronic
1192312412 X:70027900-70027922 CCTGGGGTCCTGGAGGTCCTGGG - Exonic
1192809239 X:74535093-74535115 ACTGGACCCTTGGGGCTGCTGGG - Intergenic
1194210907 X:91067346-91067368 ACTGGATCCTTTGGGTTCCTTGG - Intergenic
1195284103 X:103366712-103366734 ACTGGGGGCGTGGGGGTGGTGGG - Intergenic
1197874025 X:131085109-131085131 ACTGGGGTCTAGGGGGTTCTAGG + Intronic
1199874997 X:151922014-151922036 CCTGGGCCCTGGGAGGTCCTGGG + Intronic
1200100378 X:153687124-153687146 AGGGAGGCCTGGGGGGTCCTGGG + Intronic
1200162184 X:154015279-154015301 CCAGGCTCCTTGGGGGTCCTTGG - Intronic
1200213432 X:154356938-154356960 ACTGGGGACTTTGGGGTCTCGGG - Intronic
1201300771 Y:12502768-12502790 ACTGGGGCTTCGGGGGTCACAGG + Intergenic