ID: 1136588190

View in Genome Browser
Species Human (GRCh38)
Location 16:31201440-31201462
Sequence TGAGCTCTGCACATGCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136588181_1136588190 30 Left 1136588181 16:31201387-31201409 CCAGAGACCCTAGGGACATGGAG 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1136588190 16:31201440-31201462 TGAGCTCTGCACATGCCAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 208
1136588185_1136588190 22 Left 1136588185 16:31201395-31201417 CCTAGGGACATGGAGCTGGAGGC 0: 1
1: 0
2: 1
3: 35
4: 349
Right 1136588190 16:31201440-31201462 TGAGCTCTGCACATGCCAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 208
1136588189_1136588190 -8 Left 1136588189 16:31201425-31201447 CCTCTGAAGCATAGCTGAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 144
Right 1136588190 16:31201440-31201462 TGAGCTCTGCACATGCCAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 208
1136588183_1136588190 23 Left 1136588183 16:31201394-31201416 CCCTAGGGACATGGAGCTGGAGG 0: 1
1: 0
2: 0
3: 25
4: 234
Right 1136588190 16:31201440-31201462 TGAGCTCTGCACATGCCAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136588190 Original CRISPR TGAGCTCTGCACATGCCAGC AGG Intergenic
900350922 1:2234203-2234225 TGACCTCTGCCCACCCCAGCTGG + Intronic
900572101 1:3363678-3363700 TGAGCTGTGCACCTGCCCCCCGG - Intronic
900905133 1:5551802-5551824 TGTGCTCTGCACGTGCCAGGAGG + Intergenic
901164490 1:7208157-7208179 AGATGTCTGCACAAGCCAGCTGG - Intronic
901193442 1:7426073-7426095 GGAGCCCTGCAGATGCCAGGAGG - Intronic
901201787 1:7471412-7471434 TGAGCTCAGCCCACTCCAGCTGG + Intronic
901760131 1:11465626-11465648 TGAGCTGGGCACAGGGCAGCAGG - Intergenic
902295146 1:15462168-15462190 TGACCTCTGCTCATCACAGCTGG + Intronic
902298008 1:15481705-15481727 TGACCTCTGCTCATCACAGCTGG + Intronic
903405118 1:23089382-23089404 CGAGTTCTGCACATGCATGCAGG + Intronic
905636990 1:39560487-39560509 TGAGATCTGCAGATCCCAGTTGG - Intergenic
907318891 1:53590337-53590359 TCACCTCTGCACATGCCTTCCGG + Intronic
907443151 1:54490591-54490613 TCAGCTCTGCGCCTGCCAGGAGG - Intergenic
910087244 1:83418161-83418183 TGAACTTTTCACATGGCAGCAGG + Intergenic
911332002 1:96535535-96535557 TGAGCTTTGCACATGCCTGAGGG - Intergenic
911497801 1:98651442-98651464 TGTGCACTCCACAGGCCAGCTGG - Intergenic
912686946 1:111775361-111775383 GCAGCTCTGCACAGGTCAGCTGG + Intronic
913073754 1:115323912-115323934 AGAGCTGTGTACATGCCACCAGG + Intronic
914413276 1:147453047-147453069 TGACCTCTGAATATGCCATCTGG + Intergenic
916324226 1:163539288-163539310 TGAGCTCTGCACATTCACTCTGG - Intergenic
918950013 1:191125141-191125163 TGAGCTCTGCTCATTAGAGCAGG - Intergenic
919300862 1:195763595-195763617 TGAGTTTTGCTCATGCCTGCTGG - Intergenic
919802096 1:201360125-201360147 TGAACTCTGCACCGGCCAACAGG - Intronic
922579352 1:226685526-226685548 TGAGCTCTGGGCCTCCCAGCAGG + Intronic
924037332 1:239950564-239950586 TGAGCTCTGCTTCTCCCAGCAGG + Intergenic
1063758035 10:9038543-9038565 TTAGGTCTTCACTTGCCAGCTGG - Intergenic
1063953317 10:11244034-11244056 TGTGCCCTGCACATGCCTGCAGG - Intronic
1064278462 10:13929377-13929399 GCAGCTCTGCACCTGCCAGGTGG - Intronic
1064327823 10:14366969-14366991 TGGGCTCTGCAGATCTCAGCTGG - Intronic
1065830499 10:29609917-29609939 TGAGTTTTGCTCATGCCTGCTGG - Intronic
1069630153 10:69892650-69892672 TGTGCTTAGCACTTGCCAGCAGG - Intronic
1074317705 10:112374477-112374499 TGAGCTATCCAAATGCTAGCAGG + Intronic
1074979430 10:118608023-118608045 TGAGTTTTGCTCATGCCTGCTGG + Intergenic
1075044048 10:119132080-119132102 TCAGTTCTGCAGAAGCCAGCTGG - Intronic
1076547531 10:131255259-131255281 CCACCACTGCACATGCCAGCAGG + Intronic
1077227059 11:1443084-1443106 TGACCTCTGCCCTTGCCCGCAGG + Exonic
1077238741 11:1499494-1499516 TGAGCTTGCCACATGCCTGCGGG + Intronic
1077238758 11:1499563-1499585 TGAGCTTGCCACATGCCTGCGGG + Intronic
1077238773 11:1499632-1499654 TGAGCTTGCCACATGCCTGCGGG + Intronic
1077273828 11:1694095-1694117 TGACCTCTGCAGAGCCCAGCAGG + Intergenic
1077523763 11:3051614-3051636 ACAGCTCTGCAGCTGCCAGCAGG + Intronic
1078104846 11:8351965-8351987 TGAGATCTTCCCATACCAGCAGG + Intergenic
1079767883 11:24416699-24416721 CGACCTCTTCACATGGCAGCAGG - Intergenic
1080779477 11:35418220-35418242 GGAGCTTTCCCCATGCCAGCTGG + Intronic
1083152338 11:60799678-60799700 TGAGCTCTGCAAATACCTGGGGG - Intronic
1083485520 11:62981100-62981122 TGAGCTCTGCCGGTCCCAGCAGG - Exonic
1084840281 11:71840682-71840704 TGGTGTCTGCACATGCCATCTGG + Intergenic
1085400691 11:76233926-76233948 TGAGCTCTTTACCTGCCACCTGG - Intergenic
1087874883 11:103343213-103343235 AGAGCTCTGCTCATGGCTGCAGG - Intronic
1089095979 11:115920368-115920390 TTAGCTCTCCACATGGAAGCAGG + Intergenic
1090995888 11:131865484-131865506 TGTGCTCTGCACTTGATAGCTGG + Intronic
1091935912 12:4434436-4434458 GGAGTGCTGCAGATGCCAGCTGG + Intronic
1091971723 12:4793094-4793116 TGTGCCCTGCACAGGGCAGCTGG - Intronic
1092287272 12:7135942-7135964 TGAGCTCTCACCTTGCCAGCTGG - Exonic
1093425872 12:19028246-19028268 TCAGTTCTGCACATGACAGTTGG - Intergenic
1093479208 12:19587203-19587225 AGAGGGCTGCACATGCCTGCAGG + Intronic
1094851640 12:34384892-34384914 TGGGCTCTGCACATGCGCGGTGG + Intergenic
1098790692 12:74817743-74817765 TGTGCTCAGCTCATGCCACCAGG - Intergenic
1100209551 12:92387492-92387514 AGAGCTCTGCTCATGGCTGCAGG - Intergenic
1101493779 12:105235273-105235295 TGAGCTCTGCAGATGAAAACTGG - Intronic
1103950064 12:124545607-124545629 TGAGCTCAGCTCAGCCCAGCAGG + Intronic
1106792917 13:33174353-33174375 GGAGAACTGCACATGGCAGCTGG - Intronic
1109633570 13:65084979-65085001 TGAGTTTTGCTCAGGCCAGCTGG + Intergenic
1113895787 13:113763974-113763996 TGGGCGCTGCACCTGCCAGCCGG - Intronic
1117326166 14:54670998-54671020 TGAGCTCTGCACATCCTCGGTGG - Intronic
1117446446 14:55807801-55807823 TGTGGTCTACACATGCCATCAGG - Intergenic
1117971542 14:61255606-61255628 TGAGCTCTGCAGATGAAAGGTGG - Intronic
1120060818 14:79979723-79979745 GGATCTTTTCACATGCCAGCAGG - Intergenic
1121646781 14:95523774-95523796 TGAGCTCTGCATTTCCCAGTCGG + Intergenic
1122042385 14:98998037-98998059 TGAGCTCCTCTCATTCCAGCTGG - Intergenic
1122399704 14:101459271-101459293 TGAGCTCCGCACGTTCCATCAGG + Intergenic
1122961187 14:105094213-105094235 TGAGGTCTGCAGGGGCCAGCAGG + Intergenic
1123437015 15:20262062-20262084 GGTGCCCTGCACATACCAGCAGG + Intergenic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1126795562 15:52258062-52258084 TGAGCTCTGCAGCTCACAGCTGG + Intronic
1128666822 15:69544457-69544479 CCAGCTCTGCACTTGCTAGCGGG - Intergenic
1132826728 16:1908983-1909005 TGAGCTCTCCGCATGGCAGCTGG - Intergenic
1132875474 16:2135230-2135252 GGGGCTCTGCAGACGCCAGCGGG - Intronic
1134864417 16:17591904-17591926 TGAACTCTGCACAGGCTGGCAGG - Intergenic
1136588190 16:31201440-31201462 TGAGCTCTGCACATGCCAGCAGG + Intergenic
1136936783 16:34475678-34475700 TGTCCTCTGGACATGCCAACAGG + Intergenic
1136944951 16:34638259-34638281 TGTCCTCTGGACATGCCAACAGG - Intergenic
1136947890 16:34677403-34677425 TGTCCTCTGTACATGCCAACAGG - Intergenic
1136955280 16:34777287-34777309 TGTCCTCTGGACATGCCAACAGG - Intergenic
1136959012 16:34823788-34823810 TGTCCTCTGGACATGCCAACAGG - Intergenic
1136963036 16:34872892-34872914 TGTCCTCTGGACATGCCAACAGG - Intergenic
1137092186 16:36207367-36207389 TGTCCTCTGGACATGCCAACAGG - Intergenic
1137221650 16:46458240-46458262 TGTCCTCTGGACATGCCAACAGG + Intergenic
1137473948 16:48790388-48790410 TGAGCTCTGCAGCTGCTAACAGG + Intergenic
1139351933 16:66342482-66342504 TCAGCTGTGCAGCTGCCAGCAGG + Intergenic
1139410205 16:66752438-66752460 CCCGCTCTGCACCTGCCAGCTGG - Intergenic
1139718417 16:68832969-68832991 CCAGCTCTGCCCATCCCAGCTGG + Intronic
1139884196 16:70197133-70197155 TGAGTCCTCCACCTGCCAGCTGG - Intergenic
1140661544 16:77194519-77194541 TGCGCTCTGAACCAGCCAGCAGG - Exonic
1141483118 16:84319805-84319827 CCAGCTCTGCACCTCCCAGCTGG + Intronic
1141672569 16:85500438-85500460 TGGGCTGTGCACATGTCAGTGGG - Intergenic
1141954918 16:87364362-87364384 TGAGCGCTGCAGCAGCCAGCAGG + Intronic
1142065417 16:88059616-88059638 AGGGCTCAGCACATGCCTGCAGG - Intronic
1144837091 17:18162218-18162240 GCAGCTCTGCTCATGCCAGCTGG - Intronic
1145993498 17:29092917-29092939 TGAGCTGGGCATCTGCCAGCAGG + Exonic
1149073665 17:52574023-52574045 AGAGCTCTGCTCATGGCTGCAGG - Intergenic
1151089216 17:71416171-71416193 TGAGCTCCAAACATGACAGCAGG - Intergenic
1152009045 17:77699606-77699628 TGAGCTCTGCACATTCCCTAGGG - Intergenic
1153057740 18:964270-964292 TCAGCTCTGGACATGGCAGCAGG + Intergenic
1153277550 18:3382568-3382590 TGTGCTCTTCTCATACCAGCAGG - Intergenic
1153851934 18:9102884-9102906 TGGGCTCTGCACGGGCCTGCAGG + Intronic
1155883244 18:31176762-31176784 TGAGCTCATCACATGCTAGCTGG - Intergenic
1157182610 18:45510805-45510827 TGGCCTTTGCAAATGCCAGCTGG - Intronic
1162042354 19:7978494-7978516 TGACCTGTGCACCTGCCAGGAGG - Intronic
1164231724 19:23294798-23294820 TGAGTTCTGCACTGGGCAGCTGG + Intergenic
1165032999 19:33011869-33011891 GGTGCCCTGCACATACCAGCAGG + Intronic
1165995784 19:39842969-39842991 TGAGCCATGCACATGTCTGCAGG - Intronic
1167117604 19:47497294-47497316 TGAGATCTGCAGCTGCCACCTGG + Intronic
925387316 2:3471266-3471288 TGTGCTGTTCACATTCCAGCTGG + Intronic
925670999 2:6309869-6309891 TGAAGTCTGCAGATGCCAGACGG - Intergenic
925889821 2:8424486-8424508 TGAGCTGTGCCCATGCCACATGG - Intergenic
926173124 2:10566245-10566267 AGAGCACTGGACAGGCCAGCCGG + Intergenic
926354890 2:12032570-12032592 TGCCCTCTGCAAATGCCAGGGGG - Intergenic
926465229 2:13178491-13178513 TCACCTCTGCACATGGCGGCAGG + Intergenic
927217182 2:20674436-20674458 GGAGCTCGGGACAGGCCAGCTGG + Intergenic
927490673 2:23519022-23519044 TGGGCTCTCCACATGCCGCCTGG - Intronic
927961275 2:27241982-27242004 TGAGCACAGCACCTCCCAGCCGG - Exonic
930280887 2:49368198-49368220 TGAGCTCTGCACATGCCAAGAGG + Intergenic
931464648 2:62475598-62475620 TGAGCTCTGGGCTTGGCAGCAGG - Intergenic
934863944 2:97789204-97789226 TGTGGTTAGCACATGCCAGCAGG - Intronic
937755970 2:125539283-125539305 GTAGCTCTGCTCATGCCATCAGG + Intergenic
938208397 2:129443209-129443231 TTAGTTCTGCAGAGGCCAGCAGG - Intergenic
939851620 2:147312262-147312284 AGAGCTCTGCTCATGGCCGCAGG - Intergenic
947912549 2:233810996-233811018 AGAGCTCTGCAGATGCCCTCAGG - Intronic
948055913 2:235009226-235009248 TGAGCTCTGCAGGTGCCATCCGG + Intronic
1169308941 20:4518925-4518947 GGAGCTCAGCACATTCGAGCTGG + Intergenic
1171069760 20:22057137-22057159 TGTGCTCTGCACATGGCAGTGGG + Intergenic
1171237140 20:23536149-23536171 GGAGGTCTCCAAATGCCAGCGGG + Intergenic
1171239130 20:23551052-23551074 TGATCCCTGGACATGCCAGTGGG + Intergenic
1172974274 20:38894647-38894669 TGACCTCTGCGAAAGCCAGCAGG - Intronic
1174231075 20:49046148-49046170 TTGGCTCTGACCATGCCAGCAGG - Intergenic
1175222803 20:57426977-57426999 AGAGCTCTGCAGCTGCCTGCAGG - Intergenic
1176028050 20:62996204-62996226 TGAGGTCTGCACCTGCAGGCTGG - Intergenic
1176430322 21:6571414-6571436 AGAGCACTGCAGCTGCCAGCAGG - Intergenic
1179705716 21:43178876-43178898 AGAGCACTGCAGCTGCCAGCAGG - Intergenic
1181576180 22:23796704-23796726 TTAATTCTGCACATGTCAGCTGG + Intronic
1183255620 22:36759820-36759842 TGGGCTCTGCACCAACCAGCTGG - Intronic
1183742425 22:39676180-39676202 TGTGCCCTGCACAGGCCGGCGGG - Intronic
1184112626 22:42404152-42404174 TGACTTCTGCAAAGGCCAGCAGG - Intronic
1184878343 22:47289520-47289542 TCAGCTCTGGCCATGCCTGCAGG + Intergenic
1185082412 22:48717357-48717379 GGAGCCCTGCACATCCCAGGAGG + Intronic
1185284663 22:49994913-49994935 TGAGAACCGCACATCCCAGCAGG + Exonic
951509522 3:23486028-23486050 TGAGTTTTGCTCATGCCTGCTGG + Intronic
957429790 3:80088410-80088432 TGAGCTCTGCTAATGCCTTCTGG + Intergenic
959254900 3:103996770-103996792 TGAGCTCTGATGAAGCCAGCTGG + Intergenic
960976455 3:123179516-123179538 TGAGCTCTGCGGAGGCCAGTAGG + Intronic
962179630 3:133192344-133192366 TGAGCTTCCCACATGCCTGCTGG - Intronic
962250224 3:133831728-133831750 TGTGCTCTGGCCATGCCTGCCGG - Intronic
962684933 3:137838206-137838228 TGAGCTGAGATCATGCCAGCTGG - Intergenic
962901335 3:139764539-139764561 TGACCTCTGCAACTGCCAGACGG + Intergenic
968890551 4:3366431-3366453 TGAGCTCTGCAGATGTCTCCCGG + Intronic
969781377 4:9406685-9406707 TGGTGTCTGCACATGCCATCTGG + Intergenic
970271520 4:14353241-14353263 TGCACTCTGTACATGCCTGCTGG - Intergenic
971475527 4:27068353-27068375 TGAACTCTGGACAGGGCAGCTGG + Intergenic
973830492 4:54754532-54754554 GGAGCTATGCACATCCCAGGAGG - Intergenic
975687295 4:76929937-76929959 TGAGCTGTGATCATGCCAGTGGG + Intergenic
977246749 4:94640386-94640408 AGAGCTGAGCACATTCCAGCAGG + Exonic
978061664 4:104346142-104346164 TGTGTTCTGCTCATGCCTGCTGG - Intergenic
980582332 4:134771291-134771313 TGAGATCTACACATGTCAGAGGG - Intergenic
981007167 4:139888035-139888057 TCTTGTCTGCACATGCCAGCCGG - Intronic
981136213 4:141213738-141213760 TGAGCTCTTCACAGGCCGTCCGG - Intergenic
985838878 5:2290945-2290967 TGTATTCTGCAAATGCCAGCAGG + Intergenic
986000635 5:3628170-3628192 GGAGCCCTGCACAGGGCAGCTGG - Intergenic
987916295 5:24218911-24218933 TGACCTCTTCACAGGGCAGCAGG - Intergenic
989826887 5:45867285-45867307 TGAACTATGCATATTCCAGCAGG - Intergenic
990715027 5:58627254-58627276 TGAGCTGTGTCCATGCCACCAGG + Intronic
990947263 5:61262234-61262256 AGAGCCCTGCCCATGCCAGCAGG + Intergenic
992069295 5:73135158-73135180 TGAGCTCTGCATATGCTCTCAGG - Intergenic
994065567 5:95536482-95536504 ACATCTCTGCTCATGCCAGCTGG + Intronic
995386760 5:111596992-111597014 TGAGCTGAGCACAGCCCAGCAGG + Intergenic
996176920 5:120369642-120369664 TGAGTTTTGCTCATGCCTGCTGG - Intergenic
997228867 5:132228521-132228543 TCACCCCTGCACATGCCACCAGG - Intronic
998977567 5:147664823-147664845 TTAGTTCTACACATGCCACCTGG - Intronic
999811116 5:155128174-155128196 CCAGCTCTGCACTTGCTAGCTGG - Intergenic
1000854021 5:166377898-166377920 TGAGTTTTGCTCATGCCTGCTGG + Intergenic
1002577108 5:180180268-180180290 TCAGCTGTGCACATGCAGGCTGG + Intronic
1003308495 6:4948985-4949007 AGAGCTCTGCACATGCAAAGTGG - Intronic
1006334938 6:33415514-33415536 TGAGCTCTGCACTTCCCAGGGGG + Intronic
1006913802 6:37581785-37581807 TGGGCACTGCACATTCCATCCGG + Intergenic
1007844499 6:44742209-44742231 AGGGCACTGCACATGCCAGGGGG + Intergenic
1016914729 6:149234236-149234258 TCAAGTCTGCACATGTCAGCAGG - Intronic
1018247940 6:161840236-161840258 TGAGCTCTGCAGATGGCATCTGG + Intronic
1018393825 6:163361822-163361844 TGACCTGTGCACAGGCCAGTGGG - Intergenic
1019159956 6:170063072-170063094 TTAGCTCTGCGCACACCAGCAGG - Intergenic
1022044247 7:26610684-26610706 TGTGCTAGGCACATGGCAGCTGG + Intergenic
1023323891 7:39031584-39031606 TTAGCATTGCACTTGCCAGCCGG + Intronic
1027304120 7:76874645-76874667 TGAACTTTTCACATGGCAGCAGG + Intergenic
1027924974 7:84448179-84448201 TGAGTTTTGCTCATGCCTGCTGG - Intronic
1031827050 7:126578476-126578498 TGAGCTGTGCATTTGCCAGGTGG + Intronic
1031997405 7:128241583-128241605 TCAGCTCTGCGAATGCCACCAGG - Intronic
1033210853 7:139459277-139459299 TGAGCACAGCAAATGCCAACAGG - Intronic
1035746622 8:1965967-1965989 TGGCCTCTGCACCTTCCAGCAGG - Intergenic
1036278802 8:7380602-7380624 TGGTGTCTGCACATGCCATCTGG + Intronic
1036342717 8:7931266-7931288 TGGTGTCTGCACATGCCATCTGG - Intronic
1036759565 8:11497886-11497908 CTGGCTCTGCACCTGCCAGCTGG + Intronic
1036838060 8:12092021-12092043 TGGTGTCTGCACATGCCATCTGG - Intergenic
1036859850 8:12338269-12338291 TGGTGTCTGCACATGCCATCTGG - Intergenic
1039510825 8:38090689-38090711 AGAGATCTGCACCTCCCAGCTGG + Intergenic
1040415276 8:47189396-47189418 GGGGCTCTGCACAGGCCAGGAGG + Intergenic
1043297203 8:78680913-78680935 TCAGCCCTGCTCATTCCAGCTGG - Intronic
1045419239 8:101998023-101998045 TTAACTCTGAAAATGCCAGCTGG + Intronic
1048255938 8:132905264-132905286 TGAGCTCTGGACCAGCCTGCAGG - Intronic
1048987791 8:139744532-139744554 CCAGCTCTGCACACTCCAGCTGG + Intronic
1049389199 8:142359386-142359408 TGACCTCAGCACATCCCAGCAGG + Intronic
1049554149 8:143273939-143273961 TCAGCTCTCCTCACGCCAGCAGG - Intronic
1050809062 9:9720084-9720106 TGAGTTTTGCTCATGCCTGCTGG - Intronic
1052305111 9:26999824-26999846 TGAGCTGTGACCATGCCACCAGG - Intronic
1053510153 9:38680795-38680817 TGAGGTTTGCAGCTGCCAGCGGG + Intergenic
1056683870 9:88743714-88743736 GGAGCTTTGCACAAACCAGCCGG - Intergenic
1056692930 9:88823599-88823621 TCAGCTGCCCACATGCCAGCTGG + Intergenic
1059681493 9:116590474-116590496 ACAGCTCTGCACAGGCCAGCAGG + Intronic
1060373562 9:123098243-123098265 AGAGCTCTTCCCATGCCTGCAGG - Intronic
1061431842 9:130536297-130536319 TGAGCTAAGCAGCTGCCAGCAGG + Intergenic
1190152290 X:47958405-47958427 TCAGCTCTGTACATTCCAGTGGG - Intronic
1190160371 X:48027723-48027745 TCAGCTCTGCACATTCCAGTGGG + Intronic
1190333108 X:49247859-49247881 AGAGGTCTGCACATGGCAGAAGG + Intronic
1190453806 X:50606489-50606511 TGAGCTCTCCACAGGAGAGCAGG + Intronic
1190458462 X:50647065-50647087 AAAGCTCTGCACATAGCAGCGGG + Intronic
1190981081 X:55457066-55457088 TCTGCTCTGCACTTGCCTGCTGG - Intergenic
1190987616 X:55516114-55516136 TCTGCTCTGCACTTGCCTGCTGG + Intergenic
1201454889 Y:14159105-14159127 AGAGTTCTGCACATGGCTGCAGG - Intergenic