ID: 1136588235

View in Genome Browser
Species Human (GRCh38)
Location 16:31201693-31201715
Sequence CCGCATCTTGCTTGGGTTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136588230_1136588235 4 Left 1136588230 16:31201666-31201688 CCAGGCTGGTGTGAAACTGAAGA 0: 1
1: 0
2: 2
3: 92
4: 3727
Right 1136588235 16:31201693-31201715 CCGCATCTTGCTTGGGTTGGTGG 0: 1
1: 0
2: 2
3: 8
4: 98
1136588229_1136588235 10 Left 1136588229 16:31201660-31201682 CCAGTTCCAGGCTGGTGTGAAAC 0: 1
1: 0
2: 3
3: 16
4: 171
Right 1136588235 16:31201693-31201715 CCGCATCTTGCTTGGGTTGGTGG 0: 1
1: 0
2: 2
3: 8
4: 98
1136588227_1136588235 20 Left 1136588227 16:31201650-31201672 CCTTGCAGGTCCAGTTCCAGGCT 0: 1
1: 1
2: 1
3: 39
4: 292
Right 1136588235 16:31201693-31201715 CCGCATCTTGCTTGGGTTGGTGG 0: 1
1: 0
2: 2
3: 8
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136588235 Original CRISPR CCGCATCTTGCTTGGGTTGG TGG Exonic
901635239 1:10667466-10667488 CCGCATCGTGCTTGGGGTCTTGG - Intronic
902960805 1:19961751-19961773 CTGCATCTCCCTTGGGGTGGGGG - Intergenic
904479704 1:30786280-30786302 CAGCATCTGACTTGGGTAGGGGG - Intergenic
906980249 1:50621704-50621726 CCCGATCTTTCTTAGGTTGGAGG + Intronic
910762215 1:90744995-90745017 CCACATGTTGCTTGGATTTGGGG - Intergenic
911087444 1:93990642-93990664 CCACAGCTTGCTTGGGTTTGAGG - Intergenic
919511147 1:198466107-198466129 CTTCATCTTGTTTGGGTGGGAGG - Intergenic
1063254194 10:4308331-4308353 CTGCATCCTGCTAGGCTTGGGGG - Intergenic
1063286657 10:4695856-4695878 TCGCATCTGGCTTGGGCTGGGGG + Intergenic
1069708744 10:70475779-70475801 CAGCACCTTGCTTGGGCTGATGG + Intergenic
1073099069 10:100997725-100997747 CCGCCCCGTGGTTGGGTTGGGGG - Intronic
1075100383 10:119502443-119502465 CCGCATCCTGCTTAGAGTGGTGG - Intronic
1075143600 10:119863898-119863920 CAGTATCTTGGTTGGGTGGGAGG - Intronic
1075294854 10:121265934-121265956 CAGCATCATGCCTGGATTGGTGG + Intergenic
1077649290 11:3955279-3955301 CTGCATCTTGATTGGGGTGGTGG + Intronic
1078756917 11:14219886-14219908 CACCATGTTGCCTGGGTTGGAGG - Intronic
1079163014 11:18012411-18012433 CCGGTTCTTGCATGTGTTGGGGG - Intronic
1081366929 11:42246922-42246944 CAGCATGGTGCTTGGGTTGGGGG + Intergenic
1083163616 11:60870482-60870504 CAGGATCTTGCTGGGGTGGGAGG - Intronic
1083297916 11:61725162-61725184 CCCCTTCTTGCTCGGTTTGGAGG + Intronic
1084231222 11:67754794-67754816 CCTAATTTAGCTTGGGTTGGTGG - Intergenic
1089336234 11:117725723-117725745 CCCCATCTTCCAGGGGTTGGGGG + Intronic
1096468395 12:51861269-51861291 CCACATCTTGATTGGAATGGTGG + Intergenic
1096717922 12:53502032-53502054 CGGGGTCTTGCCTGGGTTGGCGG - Exonic
1097265167 12:57740185-57740207 CCGCAGCGTGCTTGGCCTGGTGG + Intronic
1097350683 12:58545420-58545442 TAGCAACTTGATTGGGTTGGTGG - Intronic
1099136286 12:78907078-78907100 CCTCCTCTTGTTTGGGTTTGTGG + Intronic
1102692829 12:114774808-114774830 CTACATCTTGATTGTGTTGGTGG - Intergenic
1103061284 12:117860624-117860646 TAGCATCTTGCTTGGGGTTGGGG + Intronic
1103476074 12:121219555-121219577 CCCCATCTTGATTGGATGGGTGG + Intronic
1103725979 12:122997566-122997588 CCTCGTCCTGCATGGGTTGGGGG + Exonic
1106259749 13:28056079-28056101 CATCATCTTACTGGGGTTGGGGG - Intronic
1115713213 14:36073128-36073150 CCTCATCCTGCTTGGGTGTGGGG + Intergenic
1115997918 14:39212470-39212492 CAGCCTCTTTCTTGGGTTGGGGG - Intergenic
1121753402 14:96378935-96378957 CAGCATCATGCTTGGGCTAGTGG + Intronic
1122274916 14:100586534-100586556 CCGCTTCCTGCTTGGTTTAGAGG - Intronic
1122317420 14:100834453-100834475 CCCCATCCTGCTTGGGTTTCTGG + Intergenic
1122812699 14:104296913-104296935 CCGCCTCTTGCTTGGCTTGGCGG + Intergenic
1125579147 15:40773584-40773606 GCCCCTCTTGCCTGGGTTGGTGG + Intronic
1129065452 15:72900251-72900273 TCGAATCTTCCTTGGGATGGTGG + Intergenic
1129506657 15:76087074-76087096 CCTCATCTTGATTGGGTTGGTGG + Intronic
1131309581 15:91277420-91277442 CTGTATCTTGCTTGTGTTGATGG - Intronic
1134074987 16:11284311-11284333 CCCCATCTTGCTGGGGTCAGGGG - Intronic
1134277106 16:12786347-12786369 CTGCAACTTACATGGGTTGGAGG + Intronic
1136588235 16:31201693-31201715 CCGCATCTTGCTTGGGTTGGTGG + Exonic
1146106202 17:30039546-30039568 CTGCATCTTGCTTGTGGTGGAGG + Intronic
1148573596 17:48691079-48691101 CAGCATCTTGTTTGTGTAGGTGG + Intergenic
1148809201 17:50279523-50279545 CAGCCTCTTTCTTGGGCTGGGGG - Exonic
1154267167 18:12889196-12889218 CCATATCTTGATTTGGTTGGTGG + Intronic
1160630722 18:80245427-80245449 CTGCACCTTGATTGTGTTGGTGG + Intronic
1161646615 19:5456884-5456906 CCGCCTCTGACTGGGGTTGGGGG + Intergenic
1163152083 19:15421626-15421648 CCGCATGTTCCTTGGGTCAGGGG + Exonic
1164651264 19:29892546-29892568 CGGCTTCTTGCCTGCGTTGGAGG - Intergenic
1164693869 19:30228963-30228985 GGGCATCTTGCCTGGGTCGGGGG + Intronic
1164743636 19:30594996-30595018 CTGCATCCTGCTTGGGCAGGAGG + Intronic
1165151908 19:33766010-33766032 CCGCAGCTTGCATGGGAAGGAGG - Intronic
1166746705 19:45145239-45145261 CCGCCTCTTTCTTGGGTTCACGG - Exonic
1167409349 19:49335818-49335840 CAGGAAGTTGCTTGGGTTGGGGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
932040670 2:68295793-68295815 CTGTATCTTGATTGGGATGGTGG + Intronic
932480810 2:72037977-72037999 CCACAGCTTGCTTGAGTTGGTGG - Intergenic
935265935 2:101394100-101394122 CCGCAGTTTGCTTGGGTAGCTGG - Intergenic
936996795 2:118424156-118424178 CAGCATCTGGCTAGAGTTGGTGG + Intergenic
944270894 2:197785086-197785108 CCGCAACTTGCTGGCCTTGGAGG - Intronic
948348578 2:237319904-237319926 CCTCATCTCTCTTTGGTTGGAGG - Intergenic
1172213534 20:33217560-33217582 CCTCATCTTCCTCGGGTTGCTGG + Exonic
1182047612 22:27288157-27288179 CTGCCTCCTGCGTGGGTTGGTGG + Intergenic
1183463030 22:37964186-37964208 TCGCATCTGCCTTGGGTTGTGGG - Intronic
1184634947 22:45820269-45820291 TTGCATCTTCCTTAGGTTGGTGG - Intronic
950082022 3:10229450-10229472 CCGTATCTTGATTGTGGTGGTGG - Intronic
950446750 3:13042979-13043001 CCACATGGTGCTTGGGGTGGGGG + Intronic
953384161 3:42496432-42496454 CTGCAACTTGCTTTGGTTGCTGG + Intronic
954932181 3:54293854-54293876 CTGCATCTTGATTGTGGTGGTGG + Intronic
960953226 3:123012979-123013001 CCTCCTCATGGTTGGGTTGGAGG - Intronic
961879841 3:130053805-130053827 CCTAATTTAGCTTGGGTTGGTGG - Intergenic
969390815 4:6890191-6890213 CCGCCTCTTCCCAGGGTTGGTGG + Intergenic
972305281 4:37824911-37824933 CCGTATCTTGATTGAGTTTGGGG - Intergenic
980973284 4:139586874-139586896 CTACATCTTGATTGGGGTGGTGG - Intronic
988200402 5:28062210-28062232 CAGCATCTTGATTGTGTTGATGG - Intergenic
991449727 5:66739295-66739317 TCGCATCTTTCTTCGGTTGTGGG + Intronic
992700240 5:79334440-79334462 CCACATGTTGTTTGTGTTGGGGG + Intergenic
994155000 5:96493552-96493574 CAGCATGATGCTTGGGTTGGTGG - Intergenic
996334284 5:122366144-122366166 CCTTATCTTGCTTAGTTTGGTGG - Intronic
998632519 5:143915615-143915637 CTGCATCTTGCCTGGATTTGGGG + Intergenic
1011569772 6:88723172-88723194 CCACATCATGTTTGGTTTGGAGG - Intronic
1022496058 7:30853881-30853903 CGGCTTCTTGGGTGGGTTGGAGG + Intronic
1028924607 7:96344334-96344356 CTGCATCTTGATTGAGGTGGAGG - Intergenic
1032890393 7:136189161-136189183 CTGCTTCTTGCTTGTTTTGGGGG - Intergenic
1037682782 8:21111350-21111372 CCCCATCTTGGTTGGATTTGGGG + Intergenic
1040696605 8:50007125-50007147 CCTCAACTTGCTTGGTATGGTGG + Intronic
1041122177 8:54597932-54597954 CTGCATCTTTCTTGTGGTGGTGG - Intergenic
1045017398 8:98011114-98011136 CCTCATATTGCATGGGTTGTAGG + Intronic
1047193042 8:122695851-122695873 CTGTATCTTGATTGGGATGGTGG + Intergenic
1049450900 8:142660936-142660958 CCCCAGCTCGCTGGGGTTGGAGG - Intronic
1056655424 9:88504820-88504842 CCGGGTCATGCTTGGGTTTGTGG - Intergenic
1059062650 9:111049768-111049790 CTGCATCTTGCTTTGTGTGGTGG - Intergenic
1186444415 X:9614451-9614473 ACTCATGATGCTTGGGTTGGAGG + Intronic
1189569193 X:42276991-42277013 CCTCTTCTTGTTTGGGTTGTTGG - Intergenic
1190292787 X:49003800-49003822 CCCTATCTTGCTTGTGATGGTGG - Intergenic
1190946916 X:55103910-55103932 CCCCATTTTGCTGAGGTTGGGGG - Intronic
1196784477 X:119410047-119410069 CCTCATGCTCCTTGGGTTGGAGG + Intronic
1197053478 X:122089644-122089666 CTGCATCTTGATTGGGGTGTTGG + Intergenic
1199520268 X:148726962-148726984 CCACATCTTTTTTGGGTGGGAGG - Intronic
1200182672 X:154160247-154160269 CCGTGTCTTGCTTTGGTTTGGGG + Intergenic
1200188326 X:154197361-154197383 CCGTGTCTTGCTTTGGTTTGGGG + Intergenic
1200193976 X:154234501-154234523 CCGTGTCTTGCTTTGGTTTGGGG + Intergenic
1200199731 X:154272305-154272327 CCGTGTCTTGCTTTGGTTTGGGG + Intronic
1202179484 Y:22127347-22127369 TCACATCTTGCTGGGGTGGGGGG - Intergenic
1202211877 Y:22459047-22459069 TCACATCTTGCTGGGGTGGGGGG + Intergenic