ID: 1136590321

View in Genome Browser
Species Human (GRCh38)
Location 16:31214587-31214609
Sequence CCCATCCAGTGTAGGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 337}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136590311_1136590321 16 Left 1136590311 16:31214548-31214570 CCTGAGACCGAGTTCCTCTTTCC 0: 1
1: 0
2: 0
3: 9
4: 127
Right 1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 337
1136590317_1136590321 -7 Left 1136590317 16:31214571-31214593 CCTTGGCCGTCAGAGTCCCATCC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 337
1136590314_1136590321 2 Left 1136590314 16:31214562-31214584 CCTCTTTCCCCTTGGCCGTCAGA 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 337
1136590316_1136590321 -6 Left 1136590316 16:31214570-31214592 CCCTTGGCCGTCAGAGTCCCATC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 337
1136590315_1136590321 -5 Left 1136590315 16:31214569-31214591 CCCCTTGGCCGTCAGAGTCCCAT 0: 1
1: 0
2: 0
3: 13
4: 88
Right 1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 337
1136590313_1136590321 9 Left 1136590313 16:31214555-31214577 CCGAGTTCCTCTTTCCCCTTGGC 0: 1
1: 0
2: 6
3: 29
4: 449
Right 1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG 0: 1
1: 0
2: 0
3: 14
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136590321 Original CRISPR CCCATCCAGTGTAGGATGTG AGG Intronic
901734881 1:11306044-11306066 GCCATCCTGTCTAGGAAGTGAGG - Intergenic
902540824 1:17153242-17153264 CCCTGCCAGTGTTGGAGGTGCGG + Intergenic
903596063 1:24495804-24495826 CCCAACCAATGTTGGATGTGGGG + Intergenic
904831711 1:33309766-33309788 GCCATCCCGTCTAGGAAGTGAGG - Intronic
906648076 1:47490457-47490479 CCTCTCCAGTGTTGAATGTGAGG + Intergenic
907009787 1:50952641-50952663 GCCATCCCGTCTAGGAAGTGAGG + Intronic
908467837 1:64414937-64414959 GCCACCCCGTCTAGGATGTGAGG + Intergenic
909026877 1:70492148-70492170 CCCATTCAGTGTAGTAGATGTGG - Intergenic
909460943 1:75913318-75913340 ACCCTCCAGTGTTGGAAGTGGGG - Intergenic
909622970 1:77687034-77687056 CCCATCCCGTCTGGGAAGTGAGG + Intergenic
909623095 1:77687503-77687525 CCCACCCCGTCTAGGAAGTGAGG + Intergenic
909623119 1:77687583-77687605 CCCACCCCGTCTAGGAAGTGAGG + Intergenic
910412757 1:86964061-86964083 GCCACCCCGTGTGGGATGTGAGG - Intronic
910412775 1:86964137-86964159 GCCATCCCGTCTAGGAAGTGAGG - Intronic
911163147 1:94701445-94701467 CACATGCAGTGTAGGAGATGAGG + Intergenic
911689707 1:100819323-100819345 CCCGTGCATTGTAGGATGTTTGG + Intergenic
912355712 1:109053181-109053203 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
913022859 1:114804793-114804815 GCCATCCTGTCTAGGAAGTGAGG - Intergenic
914787895 1:150850815-150850837 GCCATCCCGTCTAGGAAGTGAGG + Intronic
914959966 1:152196726-152196748 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
915112732 1:153575007-153575029 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
915762824 1:158331960-158331982 CACAGCCAGTTTAGAATGTGGGG - Intergenic
916087558 1:161281886-161281908 GCCATCCCGTCTAGGAAGTGAGG - Intronic
916864090 1:168837286-168837308 GTCATCCAGTCTAGGAAGTGAGG + Intergenic
917126711 1:171694148-171694170 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
917304547 1:173613124-173613146 GCCATCCTGTCTAGGAAGTGAGG + Intronic
918701649 1:187615867-187615889 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
920143961 1:203842062-203842084 GCCATCCCGTCTAGGAAGTGAGG - Intronic
922503904 1:226115389-226115411 GCCATCCCATGTAGGAAGTGAGG - Intergenic
922993046 1:229932028-229932050 ACCATCCCGTCTAGGAAGTGAGG - Intergenic
923174835 1:231454087-231454109 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
923716425 1:236428637-236428659 GCCATCCCGTCTAGGAAGTGAGG - Intronic
924824086 1:247521913-247521935 GCCATCCCGTCTAGGAAGTGAGG + Intronic
924943668 1:248830187-248830209 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1063118313 10:3086559-3086581 CCTGTCCATCGTAGGATGTGCGG - Intronic
1065055280 10:21837444-21837466 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1066115289 10:32233736-32233758 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1067339720 10:45391626-45391648 GCCATCCTGTCTAGGAAGTGAGG + Intronic
1067354408 10:45511941-45511963 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1067391296 10:45865826-45865848 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1067871993 10:49970326-49970348 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1067912045 10:50355806-50355828 GTCATCCCGTCTAGGATGTGGGG + Intronic
1070629720 10:78076129-78076151 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1070950785 10:80429368-80429390 CACAACCAGTCTAGGATGTTAGG + Intronic
1071259452 10:83906901-83906923 CCCATCCAGTGTGGCATCTCAGG - Intergenic
1072069951 10:91906663-91906685 CCCATCCATTGTTGAATCTGTGG - Exonic
1072772338 10:98152486-98152508 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1072772357 10:98152563-98152585 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1073238174 10:102035937-102035959 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1073274908 10:102301727-102301749 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1073305588 10:102501251-102501273 ACCATCCAGTTTAGGAATTGAGG - Intronic
1073612951 10:104962443-104962465 TCCATTCAGTGTATGGTGTGTGG + Intronic
1075013744 10:118895464-118895486 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1075108566 10:119559783-119559805 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1075181505 10:120215504-120215526 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1075842732 10:125518302-125518324 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1077719866 11:4617181-4617203 CCAATCCAGTGTCGGACTTGGGG - Intergenic
1079018277 11:16887927-16887949 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1080435366 11:32235999-32236021 CCCATGCAGTGCACGCTGTGTGG - Intergenic
1081250098 11:40819406-40819428 TCCATCCAGTGGTGGAAGTGGGG - Intronic
1082871057 11:57944096-57944118 ACCATCCCGTCTAGGAAGTGAGG - Intergenic
1083120743 11:60510136-60510158 ACCATCCCGTCTAGGAAGTGAGG + Intergenic
1083214365 11:61209301-61209323 CCCGTGCATTGTAGGATGTTTGG + Intronic
1083217249 11:61228130-61228152 CCCGTGCATTGTAGGATGTTTGG + Intronic
1083220237 11:61247878-61247900 CCCGTGCATTGTAGGATGTTTGG + Intronic
1084206617 11:67598315-67598337 GCCATCCTGTCTAGGAGGTGAGG - Intergenic
1084338463 11:68475925-68475947 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1084677977 11:70647825-70647847 CCCATCCGGGGTGGGATGGGCGG - Intronic
1084839188 11:71831359-71831381 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1085317208 11:75552891-75552913 CCAATCCAGTGTGGGATCAGGGG - Intergenic
1085443396 11:76582769-76582791 GCCATCCTGTCTAGGAAGTGAGG - Intergenic
1086017152 11:82181736-82181758 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1086017234 11:82182049-82182071 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1086446784 11:86878836-86878858 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1086446802 11:86878916-86878938 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1086446811 11:86878956-86878978 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1086446820 11:86878996-86879018 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1086446828 11:86879036-86879058 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1086446837 11:86879076-86879098 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1086446847 11:86879116-86879138 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1086941566 11:92803636-92803658 CCTGTGCACTGTAGGATGTGTGG + Intronic
1087487054 11:98770257-98770279 CGCATCCCGTCTAGGAAGTGAGG - Intergenic
1089510211 11:118991980-118992002 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1090435782 11:126685307-126685329 CCCACCCAGTGCTGGGTGTGAGG - Intronic
1092185475 12:6475567-6475589 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1092185552 12:6475879-6475901 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1092827911 12:12414971-12414993 CCCATCCCATCTAGGAAGTGAGG - Intronic
1092850053 12:12618493-12618515 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1093038458 12:14354606-14354628 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1093927782 12:24926123-24926145 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1094717023 12:33023130-33023152 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1095113953 12:38330735-38330757 ACCATCCCGTCTAGGAAGTGAGG - Intergenic
1096041487 12:48520810-48520832 GCCATCCTGTCTAGGAAGTGAGG - Intronic
1096044606 12:48551771-48551793 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1099971271 12:89503572-89503594 ACCATCCCGTCTAGGAAGTGAGG + Intronic
1101170645 12:102089343-102089365 GCCACCCAGTCTGGGATGTGAGG - Intronic
1101579899 12:106033147-106033169 CCCAACCTGGGTAGGATGTGAGG - Intergenic
1101885133 12:108655913-108655935 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1102268238 12:111507197-111507219 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1103045337 12:117731041-117731063 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1105830808 13:24161530-24161552 CCCATTCTGTGCAGGAGGTGGGG + Intronic
1107230448 13:38103925-38103947 CCCTTTCAGGGTAGGATCTGTGG - Intergenic
1107562646 13:41571881-41571903 GCCATCCTGTCTAGGAAGTGAGG + Intronic
1108097940 13:46924178-46924200 CCCATCTAGTGAAGGCTGAGTGG - Intergenic
1112070603 13:95845887-95845909 CTCATCCCGTCTAGGAAGTGAGG - Intronic
1113329074 13:109311431-109311453 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1114137189 14:19866206-19866228 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1114137199 14:19866246-19866268 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1115571407 14:34670228-34670250 CCCACCCAGGATAGGATGTGTGG + Intergenic
1116005422 14:39285907-39285929 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1118239034 14:64038224-64038246 GCCATCCTGTCTAGGAAGTGAGG - Intronic
1118239044 14:64038264-64038286 CCCATCCCATCTAGGAAGTGAGG - Intronic
1118253331 14:64183378-64183400 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1118955537 14:70477499-70477521 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1119013628 14:71024756-71024778 CCAATGCATTGTAGGATGTTTGG + Intronic
1119051919 14:71377555-71377577 GCCACCCCGTGTAGGAAGTGAGG - Intronic
1119722079 14:76898331-76898353 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1119835683 14:77747450-77747472 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1120699738 14:87685892-87685914 CTCATGCATTGTAGAATGTGTGG + Intergenic
1123429748 15:20204243-20204265 GCCATCCTGTCTAGGAAGTGAGG - Intergenic
1125861497 15:43004912-43004934 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1126691777 15:51294090-51294112 GCCATCCTGTCTAGGAAGTGAGG + Intronic
1127088622 15:55446480-55446502 GCCACCCCGTCTAGGATGTGAGG - Intronic
1127644621 15:60946801-60946823 ACCATCCCGTCTAGGAAGTGAGG + Intronic
1128843773 15:70871858-70871880 ACCATCCCGTCTAGGAAGTGAGG - Intronic
1129438191 15:75559062-75559084 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1133365084 16:5203137-5203159 GCCACCCAGTCTGGGATGTGAGG - Intergenic
1133680328 16:8114831-8114853 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1133964579 16:10521007-10521029 CCCGTACACTGTAGGATGTGTGG - Intergenic
1134229135 16:12415660-12415682 CACATCCAGGGGAGGAAGTGAGG + Intronic
1134995260 16:18734294-18734316 ACCATCCTGTCTAGGAAGTGAGG + Intergenic
1135575565 16:23583310-23583332 GCCATCCTGTCTAGGAAGTGAGG + Intronic
1135575592 16:23583426-23583448 ACCATCCCGTCTAGGAAGTGAGG + Intronic
1135694584 16:24575225-24575247 GCCATCCTGTCTAGGAAGTGAGG - Intergenic
1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG + Intronic
1136919087 16:34246252-34246274 TCCACCCCGTGTGGGATGTGAGG - Intergenic
1137303829 16:47180916-47180938 GCCATCCTGTCTAGGAAGTGAGG + Intronic
1138650635 16:58459003-58459025 CTGATCCAGTGTAGGATGGATGG + Intergenic
1139511797 16:67431976-67431998 CCCAGCCAGTGGGGGATGGGTGG - Intronic
1140047251 16:71449252-71449274 CCCTATCAGTGTAAGATGTGTGG - Exonic
1141151344 16:81566433-81566455 CTCACCCAGTGTAGCATGGGTGG - Intronic
1142068254 16:88074832-88074854 GCCTTCCAGGGTAGGATGAGGGG - Intronic
1142529808 17:572076-572098 CCCATCCCATCTAGGAAGTGAGG + Intronic
1142621201 17:1166660-1166682 CCCATCCAGTGTGGGCAGCGCGG + Intronic
1144559846 17:16312383-16312405 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1144646971 17:16981726-16981748 TGCATCCAGTCTGGGATGTGGGG + Intergenic
1144866323 17:18338105-18338127 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1145086992 17:19950842-19950864 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1146731342 17:35195436-35195458 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1149291203 17:55219139-55219161 TCCCTGCAGTGTAGGATTTGGGG - Intergenic
1149640585 17:58199965-58199987 CCCATCCTGTGTGGAATGAGAGG + Intronic
1149641275 17:58204476-58204498 TCCATCCAGGGAAGGATGTGAGG - Intronic
1149665526 17:58362631-58362653 CCCAGCCAGATTATGATGTGTGG - Exonic
1150894686 17:69196475-69196497 ACCATCCCGTCTAGGAAGTGAGG - Intronic
1154131419 18:11739774-11739796 CCCCACCAGTGTGGGAGGTGTGG - Intronic
1157705139 18:49799788-49799810 GCCATCCCGTCTAGGAGGTGAGG + Intronic
1159441813 18:68490014-68490036 CCCATACAGTTTAATATGTGTGG + Intergenic
1160333621 18:78017915-78017937 CCCACCCAGGGAAGGAGGTGAGG - Intergenic
1160588494 18:79926507-79926529 CCCATCGAGTGTGCGATCTGTGG - Intronic
1162538240 19:11276951-11276973 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1163921716 19:20296295-20296317 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1163986160 19:20952888-20952910 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1164012197 19:21212903-21212925 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1164040259 19:21487200-21487222 GTCATCCCGTCTAGGATGTGAGG - Intronic
1164064983 19:21707885-21707907 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1164071776 19:21775727-21775749 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1164105211 19:22104980-22105002 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1164231248 19:23290272-23290294 GCCATCCTGTCTAGGAAGTGAGG - Intergenic
1164256694 19:23533794-23533816 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1164457657 19:28421827-28421849 TCAATCCAGGGTAGGAGGTGGGG - Intergenic
1164659366 19:29949372-29949394 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1165057426 19:33186723-33186745 GCCCTCCAGTGTTGGAGGTGGGG - Intronic
1167588772 19:50391199-50391221 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1168644995 19:58053959-58053981 CCCTTCCAGTGTAGCGTCTGCGG + Exonic
926252797 2:11165365-11165387 ACCATCCCGTCTAGGAAGTGAGG - Intronic
926322722 2:11760142-11760164 GCCATCCCGTCTAGGAAGTGAGG - Intronic
927755586 2:25705618-25705640 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
929577862 2:43063593-43063615 CCCACCCCGTCTAGGAAGTGAGG - Intergenic
930208877 2:48614895-48614917 CCCATCCCATCTAGGAAGTGAGG - Intronic
932710874 2:74061843-74061865 GCCATCCCATGTAGGAAGTGAGG - Intronic
932718877 2:74123792-74123814 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
936952227 2:117989333-117989355 CACATCCAGAGTAGGAGGAGAGG - Intronic
937280773 2:120715938-120715960 CCCATCAAGAGCAGGATGTGGGG + Intergenic
938836168 2:135105765-135105787 GCCATCCTGTCTAGGAAGTGAGG + Intronic
938856017 2:135311778-135311800 CCCATACATTGGAGGATGTAAGG + Intronic
941025053 2:160448827-160448849 GCCATCCTGTCTAGGAAGTGAGG + Intronic
942012144 2:171774603-171774625 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
943125853 2:183792656-183792678 ACCACCCGGTGTGGGATGTGAGG - Intergenic
943578002 2:189653484-189653506 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
944722725 2:202440429-202440451 GCCATCCCGTCTAGGAAGTGAGG - Intronic
944815644 2:203372925-203372947 GCCATCCCGTCTAGGAAGTGAGG - Intronic
946012740 2:216579444-216579466 CCCATGCATTGTAGGATGTTTGG - Intergenic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
946693360 2:222327014-222327036 CCCATGGACTGTAGGAGGTGAGG + Intergenic
1169356762 20:4913189-4913211 CCCTTCCCCTGAAGGATGTGGGG - Intronic
1170422303 20:16205046-16205068 CCCCACCAGTGTAGGAGGTTGGG - Intergenic
1170592153 20:17779109-17779131 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1171368316 20:24642435-24642457 CCCTTCGAGTGTGGGCTGTGCGG - Intronic
1171951568 20:31426833-31426855 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1171957560 20:31471865-31471887 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1171986886 20:31666786-31666808 CCCCTGCAGTGGAGGATGTCCGG - Intronic
1172258156 20:33536870-33536892 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1172258175 20:33536950-33536972 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1172310633 20:33915730-33915752 CCTATAGAGTGCAGGATGTGTGG + Intergenic
1173912207 20:46678793-46678815 GACCTCCAGTGTAGGAGGTGGGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1176656746 21:9593990-9594012 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1180059028 21:45375295-45375317 ACCATGCAGAGCAGGATGTGGGG + Intergenic
1181694348 22:24585469-24585491 CCCATGGAGTCTAAGATGTGGGG - Intronic
1182331078 22:29552318-29552340 CCCATCCCGTCTAGGAAGTGAGG + Intronic
1182399770 22:30066631-30066653 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1183061096 22:35336796-35336818 ACCACCCAGTGCAGGAGGTGCGG + Intronic
950275100 3:11654055-11654077 CCTATGCATTGTAGGATGTTTGG - Intronic
952165890 3:30748191-30748213 ACCATCTAGTGAAGGATATGAGG + Intronic
953243019 3:41166356-41166378 CCCATCAGGTCAAGGATGTGGGG + Intergenic
953322345 3:41983508-41983530 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
955338852 3:58109313-58109335 CCCCTACAGGGTAGGTTGTGAGG + Exonic
957035389 3:75289239-75289261 GCCATCCCATGTAGGAAGTGAGG + Intergenic
957789233 3:84918646-84918668 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
958560813 3:95744991-95745013 GCCATCCTGTTTAGGAAGTGAGG + Intergenic
958692009 3:97480938-97480960 GCCATCCCGTCTAGGAAGTGAGG - Intronic
958943513 3:100338878-100338900 CCTATGCATTGTAGGATGTTTGG + Intronic
959311237 3:104740306-104740328 CCCATCCCTTATAGCATGTGAGG - Intergenic
963776437 3:149445206-149445228 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
966989464 3:185214273-185214295 CCCAACCACTGTAGCCTGTGAGG + Intronic
967127296 3:186435663-186435685 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
968139467 3:196244339-196244361 GCCATCCCGTCTAGGAAGTGAGG + Intronic
968156472 3:196385419-196385441 GCCACCCAGTCTAGGAAGTGAGG + Intronic
972270783 4:37509462-37509484 GCCATCCCGTCTAGGAAGTGAGG - Intronic
972695678 4:41443799-41443821 TCCAGCCTGTGAAGGATGTGAGG + Intronic
973263314 4:48186390-48186412 GCCATCCCGTCTAGGAAGTGAGG + Intronic
973945464 4:55949907-55949929 CCCCTCCAAAGCAGGATGTGAGG + Intronic
974870505 4:67636925-67636947 GCCATCCCGTCTAGGAAGTGAGG + Intronic
975848325 4:78547912-78547934 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
975908730 4:79245159-79245181 GCCATCCCGTCTAGGAAGTGAGG + Intronic
978014230 4:103723236-103723258 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
979273667 4:118792019-118792041 CTCATCCCGTCTAGGAAGTGAGG + Intronic
979702480 4:123684890-123684912 CTCATCCTGTCTAGGAAGTGAGG + Intergenic
980002712 4:127509130-127509152 CCTATCCAGTGAAGGATTTTTGG - Intergenic
981939864 4:150271122-150271144 CCCAGCCAATGGAGGCTGTGAGG + Intronic
982075249 4:151731648-151731670 GCCATCCCGTCTAGGAAGTGAGG + Intronic
982723426 4:158881984-158882006 GCCATCCAGTCTAGGAAGTGAGG + Intronic
983613802 4:169679313-169679335 GCCATCCCGTCTAGGAAGTGAGG - Intronic
983906081 4:173184061-173184083 CTCATCCTGTCTAGGAAGTGAGG - Intronic
984254602 4:177376239-177376261 TCCCTCCAGCGTAAGATGTGTGG - Intergenic
985216338 4:187658026-187658048 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
985677648 5:1240459-1240481 CTCATCCAGGGGAGGAAGTGAGG - Intronic
986316734 5:6594100-6594122 CCCAGCCATAGTGGGATGTGAGG + Intergenic
987373565 5:17215597-17215619 CCTATGCACTGTAGGATGTCTGG - Intronic
989068218 5:37484017-37484039 GCCATCCCGTCTAGGAAGTGAGG - Intronic
989372227 5:40722439-40722461 GTCATCCAGTCTAGGAAGTGAGG + Intronic
990297806 5:54420826-54420848 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
991073867 5:62514014-62514036 CCCATCCCATCTAGGAAGTGAGG - Intronic
991093803 5:62718570-62718592 CCCCTGGAGGGTAGGATGTGTGG + Intergenic
992977948 5:82139375-82139397 CCCATCCCATCTAGGAAGTGAGG + Intronic
997035220 5:130182654-130182676 GTCATCCATTGTAGGATGTAGGG + Intronic
998060018 5:139112378-139112400 GCCATCCCGTCTAGGAAGTGAGG + Intronic
998060035 5:139112454-139112476 GCCACCCAGTCTGGGATGTGAGG + Intronic
999532691 5:152480196-152480218 GCCACCCAGTCTGGGATGTGAGG - Intergenic
999532710 5:152480272-152480294 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1000103497 5:158037460-158037482 GCCATCCAGTCTAGGAAGTGAGG - Intergenic
1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG + Intronic
1000334974 5:160235474-160235496 CACCTCCAGTGTAGGAGGAGTGG - Intronic
1000630302 5:163584048-163584070 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1002287842 5:178177092-178177114 TCCAGCCACTGTAGAATGTGGGG + Intergenic
1004152437 6:13133868-13133890 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1005860437 6:29896127-29896149 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1006826796 6:36941554-36941576 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1007235901 6:40391379-40391401 CCCTTCCAGTGTCGGGTGTGGGG + Intergenic
1007651432 6:43425078-43425100 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1008377669 6:50810231-50810253 GCCATCCTGTCTAGGAAGTGAGG - Intergenic
1009049023 6:58257657-58257679 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1009846745 6:69144993-69145015 TCCAAACAATGTAGGATGTGAGG - Intronic
1010192108 6:73205822-73205844 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1011082465 6:83504476-83504498 CCTGTGCAGTGTAGGATGTTTGG - Intergenic
1011297180 6:85838483-85838505 GCCATCCCATGTAGGAAGTGAGG + Intergenic
1011426891 6:87239814-87239836 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1012899649 6:104991475-104991497 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1012983757 6:105854359-105854381 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1013204502 6:107934254-107934276 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1013530845 6:111017675-111017697 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1014123374 6:117750922-117750944 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1014800288 6:125770731-125770753 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1015060669 6:128961224-128961246 ACCATGCAGTGAAGGATGAGGGG - Intronic
1015070658 6:129088776-129088798 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1016123687 6:140374130-140374152 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1016390443 6:143569170-143569192 TCCAGCCAGTGTGGGCTGTGAGG + Intronic
1016589880 6:145732940-145732962 ACCAACCAGTGTGGGATTTGAGG - Intronic
1017856021 6:158350189-158350211 CCCACCCTGTCTAGGAAGTGAGG - Intronic
1018786883 6:167115162-167115184 CCCATCCAGTGTCTGAGGAGTGG - Intergenic
1019577224 7:1743382-1743404 CCCAGCCTGAGGAGGATGTGTGG + Intronic
1020355749 7:7273871-7273893 CCCATGCTGTGCAGGATGTCTGG + Intergenic
1020365735 7:7378878-7378900 CCCATGCAGTGTAGGACTAGTGG - Intronic
1021975273 7:26006391-26006413 CCCATCCAGAGGTGGATGAGGGG - Intergenic
1021991814 7:26148029-26148051 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1022731913 7:33034694-33034716 CCCAACCAGTGTAGGATCAAAGG - Intronic
1023852308 7:44157334-44157356 CCCAAGCAGTGTAGGAAATGTGG + Intronic
1025852767 7:65257887-65257909 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1029582039 7:101443180-101443202 GCAATCCAGTGCAGGATGGGGGG - Intronic
1029963150 7:104709785-104709807 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1030388978 7:108902124-108902146 TCCATCCAGTTTAAGATTTGAGG + Intergenic
1031716803 7:125118447-125118469 CCTAGCCAGTGTTGGAGGTGAGG + Intergenic
1032028602 7:128463396-128463418 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1032156969 7:129476637-129476659 GCCATCCAGTCTAGGAAGTGAGG - Intronic
1033173127 7:139101376-139101398 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1033294007 7:140114701-140114723 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1034922703 7:155096975-155096997 GCCACCCTGTCTAGGATGTGAGG - Intergenic
1035073806 7:156164065-156164087 CCCAGCCACTGTTGGATGTGTGG + Intergenic
1036737150 8:11329847-11329869 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1038481143 8:27902460-27902482 CCCATGCTGTGGAGGATGCGTGG - Intronic
1039153454 8:34529658-34529680 ACCATCCCGTCTAGGAAGTGAGG - Intergenic
1039753216 8:40496689-40496711 TCCATCCCGTCTAGGAAGTGAGG - Intergenic
1041463721 8:58138547-58138569 CCCAGCCAGTGTGAGATGAGAGG + Intronic
1042290796 8:67167759-67167781 GCCATCCCGTTTAGGAAGTGAGG - Intronic
1043611745 8:82072661-82072683 CACATCCAGTGTAACATGAGAGG + Intergenic
1043958599 8:86390157-86390179 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1044969384 8:97604887-97604909 ACCATCCCGTCTAGGAAGTGAGG + Intergenic
1044969413 8:97605003-97605025 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1045195601 8:99927152-99927174 ACCATCCCGTCTAGGAAGTGAGG + Intergenic
1045235743 8:100351291-100351313 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1048158282 8:131984556-131984578 CCCCCCCAGTGTAGGAAGTGTGG - Intronic
1052928630 9:34038816-34038838 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1054359661 9:64100879-64100901 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1055580616 9:77703287-77703309 GCCACCCAGTCTAGGAAGTGAGG - Intergenic
1057630547 9:96715979-96716001 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1057716238 9:97498355-97498377 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1058117175 9:101097730-101097752 TCCACCCAGAGGAGGATGTGTGG + Intronic
1058244215 9:102603581-102603603 GCCATCCCGTCTGGGATGTGAGG - Intergenic
1059856078 9:118398808-118398830 CCCATCCAGCATAGAATTTGGGG - Intergenic
1060625508 9:125108365-125108387 GCCATCCCGTCTAGGAAGTGAGG + Intronic
1061977254 9:134075692-134075714 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1203634459 Un_KI270750v1:97474-97496 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1188086364 X:25905789-25905811 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1188214255 X:27458373-27458395 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1188492757 X:30754232-30754254 GCCATCCTGTCTAGGAAGTGAGG - Intergenic
1189341971 X:40211234-40211256 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1189421511 X:40862001-40862023 GCCACCCAGTCTGGGATGTGAGG + Intergenic
1189427010 X:40910714-40910736 CCCCCCCAGTGTTGGAGGTGGGG - Intergenic
1190505327 X:51119956-51119978 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1190769556 X:53503941-53503963 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1190769566 X:53503981-53504003 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1192739863 X:73882219-73882241 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1193328936 X:80215033-80215055 GCCATCCCGTCTAGGAAGTGAGG + Intergenic
1193943262 X:87702886-87702908 CAAAGCCTGTGTAGGATGTGGGG + Intergenic
1194350565 X:92821521-92821543 CCCACACCGTGTAGGAAGTGAGG + Intergenic
1194714744 X:97275740-97275762 GCCATCCCGTCTAGGAAGTGAGG - Intronic
1196162417 X:112500400-112500422 CCCATTCAGTATAGTATTTGTGG + Intergenic
1197199248 X:123734060-123734082 GCCATCCTGTCTAGGAAGTGAGG + Intergenic
1198600875 X:138283084-138283106 GCCATCCCGTCTAGGAAGTGAGG - Intergenic
1198658051 X:138936151-138936173 CACAACCAGTGTAGACTGTGGGG - Intronic
1200952959 Y:8918359-8918381 GCCATCCTGTCTAGGAAGTGAGG - Intergenic
1201335717 Y:12878550-12878572 CCCACCCCGTCTAGGAAGTGAGG + Intergenic