ID: 1136592429

View in Genome Browser
Species Human (GRCh38)
Location 16:31225351-31225373
Sequence AACTAAGGTTGAGCGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136592423_1136592429 -4 Left 1136592423 16:31225332-31225354 CCTGAGAATTCCAGGAAGAAACT 0: 1
1: 0
2: 4
3: 54
4: 400
Right 1136592429 16:31225351-31225373 AACTAAGGTTGAGCGAGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 176
1136592421_1136592429 4 Left 1136592421 16:31225324-31225346 CCAGGAGGCCTGAGAATTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 224
Right 1136592429 16:31225351-31225373 AACTAAGGTTGAGCGAGGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136592429 Original CRISPR AACTAAGGTTGAGCGAGGGA GGG Intronic
901429997 1:9208177-9208199 AAAAAAGGCTGAGCGAGGGATGG - Intergenic
901677618 1:10895742-10895764 AACTAAGGTGGCGGGAGGCATGG + Intergenic
903210745 1:21816755-21816777 AAAAAAGGCTGAGCGGGGGATGG - Intronic
904470812 1:30735085-30735107 AACCAAGGTCCAGAGAGGGAAGG + Intronic
904840165 1:33367487-33367509 AACTAAGAGGGAGAGAGGGATGG + Intronic
905181485 1:36169844-36169866 AACTGAGGCTGAGCCAGGCATGG + Intronic
906653666 1:47532938-47532960 AAATAAGGCTCAGAGAGGGAAGG - Intergenic
906807022 1:48789081-48789103 AACTGAGGTTCAGAGAGGGAGGG + Intronic
909308318 1:74111754-74111776 AACTGGGGTTGAGGGAGGAAGGG - Intronic
909717828 1:78730968-78730990 AACTAAAGTTGAGCAAGAGTAGG - Intergenic
910194145 1:84623177-84623199 AACTAAGCTTAAGCGAGGTTAGG - Intergenic
910262381 1:85304907-85304929 AACCAAGGTTTAGAGAGGAATGG + Intergenic
910682332 1:89880000-89880022 AAGTAAGGTTGAAAGAGGCAAGG + Intronic
911526531 1:98994174-98994196 AAGGAAGGATGAGAGAGGGAGGG + Intronic
912587333 1:110778998-110779020 AAGTAAGGTTGAGAGAGGGAAGG + Intergenic
914195716 1:145446968-145446990 CACTAGGGGTGAGGGAGGGAGGG + Intergenic
914372734 1:147044024-147044046 AATTAAGTTTGAGCCAGGCATGG + Intergenic
915457847 1:156052648-156052670 AACTGAGGATCAGCGAGGTAAGG + Intronic
917455537 1:175182707-175182729 AACTAAGGCACAGAGAGGGAAGG - Intronic
919082356 1:192882022-192882044 AAATAAGGATGAGGGAGGGAGGG - Intergenic
919927296 1:202198919-202198941 AACTAAGACTGGGCCAGGGAAGG - Intronic
920116307 1:203624334-203624356 AAGGAAGGTAGAGGGAGGGAAGG + Intergenic
920310190 1:205044055-205044077 AGCTAAGGTTGGGAGGGGGAAGG - Intronic
921913257 1:220576007-220576029 AAGAAAGGATGAGGGAGGGAGGG - Intronic
922516270 1:226210519-226210541 AACTAAGGCTCAGAGAGGAAAGG + Intergenic
1065858843 10:29853561-29853583 AAATAAAATTGAGCGAGGCAGGG + Intergenic
1066271070 10:33824063-33824085 AATTAAGGTTCAGAGAGGTAAGG + Intergenic
1069910440 10:71755527-71755549 AACTGAGGCTCAGAGAGGGAAGG + Intronic
1070712247 10:78691281-78691303 AACTAAGATTCAGGGAGGTAAGG + Intergenic
1071329837 10:84548492-84548514 AACTAGGGGTGAGGGATGGAGGG - Intergenic
1074100823 10:110353883-110353905 ATCTAAGGTTGGGAGAGGGAAGG + Intergenic
1079815987 11:25058665-25058687 AATTAAGGTTCAGAGAGGGAAGG + Intronic
1081634278 11:44710614-44710636 AACAAATGCTGAGGGAGGGAGGG - Intergenic
1081989913 11:47332263-47332285 AAATAAGGTAAAGAGAGGGAGGG + Intronic
1082222629 11:49658704-49658726 AACTAAAGTTGAGTGAGTGCTGG - Intergenic
1083421537 11:62556097-62556119 AACTAGGGTAGAATGAGGGAAGG - Intronic
1083620609 11:64047590-64047612 AACTGAGGTTAATAGAGGGAAGG + Intronic
1083675330 11:64321931-64321953 AATTAAGGGGGAGCTAGGGAGGG + Intergenic
1083735436 11:64677605-64677627 AACAGAGGGTGAGAGAGGGAAGG + Intronic
1084193103 11:67507888-67507910 AACTGAGGCTCAGCGAGGGTAGG + Intronic
1084448481 11:69218186-69218208 AACTGAGGCAGAGAGAGGGAAGG + Intergenic
1086626417 11:88960498-88960520 AACTAAAGTTGAGTGAGTGCTGG + Intronic
1088112630 11:106279385-106279407 AACCAAGGTTTAGAGAAGGAGGG + Intergenic
1089354669 11:117841876-117841898 AACCAAGGGTGAGAGAGGAAGGG + Intronic
1090263815 11:125341774-125341796 ATCTTAGGTTGGGCGACGGAGGG + Intronic
1091641064 12:2237895-2237917 AATAAAGGTGGAGCTAGGGAGGG - Intronic
1096096915 12:48941543-48941565 AAGTAAGGTTAGGGGAGGGAGGG - Intronic
1096443070 12:51662677-51662699 AATTAAGGTTGAGAGTGAGATGG + Intronic
1098353376 12:69585965-69585987 AACTAAGAATGAGGCAGGGAGGG - Intronic
1099103612 12:78473914-78473936 AAATCAGGTTGAGAGAGAGACGG + Intergenic
1099752320 12:86791722-86791744 AACTAATGCTGAGAAAGGGATGG - Intronic
1099915985 12:88893797-88893819 AGGTCAGGGTGAGCGAGGGAAGG + Intergenic
1100678165 12:96890882-96890904 AACTAAGGTTGAGCGGGTTAAGG + Intergenic
1102016796 12:109653438-109653460 AACTAAGGCTCAGAGAGGTAAGG - Intergenic
1102036792 12:109775205-109775227 AACTGAGGTTCAGAGAGGGGAGG + Intergenic
1108774365 13:53746236-53746258 AACTAAAGTAGAGATAGGGAAGG + Intergenic
1113969838 13:114180450-114180472 AAGTGAGGTTGAGCTGGGGAAGG - Intergenic
1116198567 14:41760672-41760694 AATGAAGGATGAGAGAGGGAGGG + Intronic
1119566270 14:75631739-75631761 AAGTGAGGTGGAGCGTGGGAAGG - Intronic
1121202227 14:92127922-92127944 GACTAGGGTGGAGGGAGGGATGG + Intronic
1121837749 14:97107085-97107107 AACGAAGGATGAGGGATGGAAGG + Intergenic
1124997671 15:34739510-34739532 AACTAAGGTTTAGCAAGGTTAGG + Intergenic
1125398054 15:39271215-39271237 CAGGAAGGTTGAGCGTGGGAAGG - Intergenic
1125662927 15:41408297-41408319 AACTCAGGTAGTGCCAGGGAGGG + Intergenic
1129251570 15:74312096-74312118 AACTGAGGTTCAGAGAGGGAAGG + Intronic
1129380056 15:75158946-75158968 AACTGAGGCTGAGAGAAGGAAGG - Intergenic
1129577162 15:76762647-76762669 TACTAAGGTAGAGTGGGGGAGGG - Intronic
1130829303 15:87583392-87583414 AACTAAAGTTTAGTGAGGGAAGG - Intergenic
1132772684 16:1573099-1573121 AACTGAGGGTGAGGGACGGATGG + Intronic
1133267133 16:4591986-4592008 AACCAAGGCTCAGAGAGGGAAGG + Intronic
1136592429 16:31225351-31225373 AACTAAGGTTGAGCGAGGGAGGG + Intronic
1137424155 16:48363450-48363472 AACTAAGGTGAAGTGAGGCATGG + Intronic
1137607634 16:49797075-49797097 CCCTAAGGTTGAGCTAAGGAGGG - Intronic
1138042687 16:53690702-53690724 AACTAAGGTTCAGAGAGGATAGG + Intronic
1138190229 16:55008721-55008743 AACTGAGGTTCAGGGAGGCATGG + Intergenic
1142650183 17:1344685-1344707 AAAAGAGGTTGAGCGAGCGAAGG + Exonic
1143302666 17:5922396-5922418 AGCCAAGGTTGAGTGAGGCAGGG + Intronic
1144642324 17:16944426-16944448 AACTAAGGCTCAGAGAGGGTCGG + Intronic
1144830677 17:18129432-18129454 AACTGAGGTCCAGAGAGGGATGG - Intronic
1147793703 17:43028272-43028294 AACAAAGGATGAGCCAGGTAAGG - Intronic
1150078664 17:62216875-62216897 AACTTAGGTGCAGCGAGGAAAGG - Intergenic
1152226329 17:79094528-79094550 AACTAGGGAAGAGCGTGGGAGGG + Exonic
1203192993 17_KI270729v1_random:206768-206790 AACTGAGGCTTAGAGAGGGAAGG - Intergenic
1203202357 17_KI270730v1_random:6203-6225 AACTGAGGCTTAGAGAGGGAAGG - Intergenic
1155354506 18:24938262-24938284 ATCTAAGGTTGAGAGAGGAGGGG + Intergenic
1157022705 18:43805749-43805771 AACTAGGGTTGGGGGAGGGGTGG + Intergenic
1160488878 18:79320234-79320256 AACTGAGGTTCTGGGAGGGAAGG + Intronic
1160521043 18:79508211-79508233 AAAAAAGGTGGAGGGAGGGAGGG + Intronic
1161261795 19:3341848-3341870 AACTGAGGCTGAGAGAGGAAGGG - Intergenic
1161268493 19:3376043-3376065 AACTAAGGCTCAGAGAGGGGCGG - Intronic
1161470874 19:4456289-4456311 AGCAAAGGCTGAGTGAGGGAGGG - Intronic
1162107517 19:8379013-8379035 AACTGAGGATGATAGAGGGAGGG + Intronic
1162503832 19:11070460-11070482 AACTTAGGTTGAGGGGGGCAAGG + Intergenic
1163368124 19:16887743-16887765 AACTAGGGATGGGGGAGGGAGGG - Intergenic
1163526342 19:17823859-17823881 ATCTGAGGTTGAGAGAGGGAAGG + Intergenic
1165312146 19:35034781-35034803 AACCAAGGCTCAGGGAGGGAAGG + Intronic
1165794194 19:38509192-38509214 AACTGAGGTCTAGAGAGGGAAGG - Intronic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
930902721 2:56527327-56527349 AACTAAGGCTCAGAGAGTGAAGG + Intergenic
933951244 2:87332215-87332237 AACTGAGGTTGAGTGAGGCCTGG + Intergenic
934943790 2:98521356-98521378 AACTAATGTTGACCAAGGAATGG - Intronic
936328534 2:111526360-111526382 AACTGAGGTTGAGTGAGGCCTGG - Intergenic
938687709 2:133756603-133756625 ACCTAATGCAGAGCGAGGGAGGG - Intergenic
945947036 2:216004267-216004289 AACAAAAGTAGAGCAAGGGAGGG - Intronic
947041384 2:225924875-225924897 GACTAAGGTAGAGGGAGGGTAGG - Intergenic
947421217 2:229942946-229942968 AAATAAGGGTGAGGGAGGCATGG - Intronic
947628661 2:231637455-231637477 AAGAAAAGTTGAGGGAGGGAAGG + Intergenic
949065558 2:241988194-241988216 AACTATGATTGTGCCAGGGATGG + Intergenic
1169879739 20:10333495-10333517 ACCTAAGGTAGAGGGTGGGAGGG - Intergenic
1169990763 20:11500139-11500161 AACTAATGTCAAGGGAGGGAAGG + Intergenic
1172013961 20:31862116-31862138 AACAAAGGATGAGAGGGGGAGGG - Intronic
1172484794 20:35291727-35291749 AACTGAGGTCCAGAGAGGGAAGG - Intronic
1172630861 20:36377361-36377383 AACCAAGGTTCAGAGAAGGAAGG - Intronic
1178995975 21:37400217-37400239 CACAAATGTTGAGAGAGGGAGGG - Intronic
1180856042 22:19046016-19046038 AAATCAGGTGGAGCGAGGCATGG - Intronic
1182021917 22:27088775-27088797 AAATGAGGTTGAGGGATGGAAGG - Intergenic
1182433635 22:30315994-30316016 AACCAAGGGTGAGCAAGTGATGG - Intronic
1182451555 22:30424815-30424837 AACTGAGGTCCAGCGGGGGAAGG + Exonic
1183063512 22:35349170-35349192 AACTGAGGCTGAGGGAGGAAGGG + Intergenic
1183717758 22:39543827-39543849 AACTAAGGCTGAGAGAGAAAAGG - Intergenic
1184411715 22:44329958-44329980 AACAAAGGGTGATGGAGGGAGGG + Intergenic
949540407 3:5027492-5027514 AACTGAGGTTCAGAGAGGGCAGG + Intergenic
949662899 3:6302261-6302283 TACCAAGGATGAGAGAGGGAAGG - Intergenic
953511352 3:43543149-43543171 AACTAAGAGAGAGGGAGGGAAGG - Intronic
953739316 3:45523413-45523435 AGCTAAGGATCAGCAAGGGAGGG - Intronic
954794682 3:53155472-53155494 AACTGAGGCTGAGAGAGGGCTGG + Intergenic
955120878 3:56056965-56056987 AACTAAGGTTGAGAAGGGTAAGG + Intronic
955749711 3:62175625-62175647 AAATAAAGTTGAACAAGGGATGG + Intronic
960621974 3:119645916-119645938 AAGTAAGGTTTAGTGAGGTATGG + Intronic
964384834 3:156136565-156136587 AAGTAATGTTGAGCCATGGAAGG - Intronic
965641718 3:170835961-170835983 AACTAAGGGTTTGGGAGGGAGGG - Intronic
968824532 4:2884996-2885018 AAATAAGTTTGAGAGACGGAAGG - Intronic
971274227 4:25180539-25180561 AACTGAGGCTCAGAGAGGGAAGG + Intronic
972134829 4:35878884-35878906 AACTGTGGTTGAGAGACGGAAGG - Intergenic
973711426 4:53633626-53633648 AACTAGTGTTTAGCCAGGGAAGG + Intronic
979600862 4:122585512-122585534 AAATAAGGTTGGGGGAGGGGTGG - Intergenic
980456662 4:133053192-133053214 AAGTAAGGTTGAGAAAGGCAGGG + Intergenic
985169263 4:187130939-187130961 AACTAAGGCTTAGAGAGGGAAGG + Intergenic
988145319 5:27298499-27298521 AACTAAGGTAGAGCCAAGAATGG - Intergenic
989395939 5:40956774-40956796 AAATATGGGTGAGGGAGGGAGGG + Intronic
990498181 5:56369360-56369382 GATGAAGGTTGAGCAAGGGATGG + Intergenic
990503336 5:56419443-56419465 AACTGAGGTTCAGCGAGGCTAGG - Intergenic
992437008 5:76763987-76764009 AAAAAAGGATGAGAGAGGGAAGG + Intergenic
993510871 5:88770087-88770109 AACAAAGGTTGAGAGAGGAAAGG + Intronic
994082126 5:95718703-95718725 CACTAAGGTTGATCCAGGGTTGG + Intronic
994215458 5:97132459-97132481 GAATGAGGTTGAGGGAGGGATGG + Intronic
999197133 5:149790054-149790076 AACTAAGGTTCAGAGAGGTTAGG - Intronic
999440637 5:151597875-151597897 AGCTGAGGTTAAGAGAGGGAAGG + Intergenic
1002580680 5:180208170-180208192 AACTGAGGTTTAGAGAGGGGCGG - Intronic
1003392100 6:5723134-5723156 AAGTAAGGGTGAGTGAGTGAAGG + Intronic
1004549729 6:16635387-16635409 GACTAGGGTGGAGCGGGGGATGG - Intronic
1005210252 6:23452475-23452497 GACGAAGGTTGAGCATGGGAGGG - Intergenic
1006038180 6:31230494-31230516 AAAGAAGGTTGATCCAGGGAAGG + Intergenic
1009282302 6:61768449-61768471 AAATGAGGTTGAGAAAGGGATGG - Intronic
1009750189 6:67871767-67871789 TACTGACGTTGAGCGAGGTAAGG + Intergenic
1013201205 6:107897972-107897994 AACTAAGGTTTAGCCAGGCTTGG + Intronic
1013646970 6:112154231-112154253 ATCCAAGGGTGAGGGAGGGAAGG - Intronic
1015462310 6:133505472-133505494 GACTAAGGTTGAAGAAGGGAGGG - Intronic
1022773327 7:33498076-33498098 AACTAAGTTTGAGGGAGGTAAGG + Intronic
1023615756 7:42017647-42017669 AACCAAGGTTGAACGAGGCAAGG + Intronic
1025115201 7:56251987-56252009 AACTGAGGTTTAGGGAGGCAAGG + Intergenic
1025167528 7:56725863-56725885 AACTAAGGTTGAAAGAAGGGAGG + Intergenic
1029028841 7:97447684-97447706 AACTAAGGTTCAGAGAGGATGGG - Intergenic
1032986557 7:137343762-137343784 GACGAAGGCTGGGCGAGGGAGGG + Exonic
1033399360 7:141007284-141007306 AACTAAGGTGCAGGGAGGTAAGG - Intronic
1036698320 8:10993835-10993857 AGCTAAGGCTGAGTGAGGTAGGG - Intronic
1039445842 8:37631212-37631234 AATTAAGGTTGAGGGATGGTAGG - Intergenic
1039864454 8:41489462-41489484 AACTAATGTTGAGTGACAGAAGG + Intergenic
1045233669 8:100330357-100330379 AACCAAGAATGAGGGAGGGATGG - Intronic
1046205509 8:110990349-110990371 AACTCAGGTGGAGGGAGGGGAGG - Intergenic
1046514370 8:115239631-115239653 AACTGAGGTTTAGCGAGGTTAGG - Intergenic
1048005272 8:130414486-130414508 AACTGAGGTTCAGAGAGGTAAGG - Intronic
1048333077 8:133484387-133484409 AACTGAGGCTGAGGGAGGGCAGG + Intronic
1050625638 9:7501158-7501180 AACTAAAATTCAGCGAGGTAAGG + Intergenic
1057847901 9:98539521-98539543 AACTAAGGCCCAGAGAGGGAAGG - Intronic
1059154831 9:111980479-111980501 CTCTAAGGATGAGCGAGGCAGGG + Intergenic
1060402703 9:123357541-123357563 AACCAAGGCTCAGAGAGGGACGG + Intronic
1060995629 9:127873707-127873729 AACTGAGCTCGAGAGAGGGAAGG + Intronic
1061394249 9:130334837-130334859 AATAAAGGGTGAGGGAGGGAGGG - Intronic
1061668149 9:132172400-132172422 AACTAAGGTTCAGAGAGGTTAGG - Intronic
1062424576 9:136500186-136500208 AGCCAAGGTTGAGGGAGGGGCGG + Intronic
1062698950 9:137889382-137889404 CACTAGGGGTGAGGGAGGGAGGG - Intronic
1187092566 X:16112352-16112374 AACTAATGTTGAGTGATGGTCGG - Intergenic
1188646641 X:32576714-32576736 AACCATGGATGAGGGAGGGAGGG + Intronic
1192192045 X:68996774-68996796 AACTGAGGTTCAGAGAGGCAGGG + Intergenic
1194744704 X:97615674-97615696 AACTAAGGCTCAGGGAGGTAAGG + Intergenic
1195377566 X:104242799-104242821 AGGTAAGGTTGAGAAAGGGAAGG + Intergenic
1196733970 X:118968586-118968608 AACTGAGGATGAGGTAGGGAGGG + Intergenic
1199298665 X:146187366-146187388 AACTGGGGTGGAGGGAGGGAAGG - Intergenic
1199533789 X:148879274-148879296 AACTGAGGTTCAGAGAGGGTAGG + Intronic
1199685991 X:150266166-150266188 AACTGAGGATCAGTGAGGGAAGG - Intergenic