ID: 1136595528

View in Genome Browser
Species Human (GRCh38)
Location 16:31246645-31246667
Sequence TAATCACTTAGAACCATGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136595525_1136595528 23 Left 1136595525 16:31246599-31246621 CCTTCTTCATAGGATTTCTATGA No data
Right 1136595528 16:31246645-31246667 TAATCACTTAGAACCATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136595528 Original CRISPR TAATCACTTAGAACCATGTC TGG Intergenic
No off target data available for this crispr