ID: 1136596132

View in Genome Browser
Species Human (GRCh38)
Location 16:31251301-31251323
Sequence CCATGCTCTTTGTGTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136596127_1136596132 0 Left 1136596127 16:31251278-31251300 CCCTGCAAGTCACCTGTGGCCAA No data
Right 1136596132 16:31251301-31251323 CCATGCTCTTTGTGTGACCTTGG No data
1136596128_1136596132 -1 Left 1136596128 16:31251279-31251301 CCTGCAAGTCACCTGTGGCCAAC No data
Right 1136596132 16:31251301-31251323 CCATGCTCTTTGTGTGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136596132 Original CRISPR CCATGCTCTTTGTGTGACCT TGG Intergenic
No off target data available for this crispr