ID: 1136597322

View in Genome Browser
Species Human (GRCh38)
Location 16:31260290-31260312
Sequence CCACATTCATGGACTGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136597315_1136597322 13 Left 1136597315 16:31260254-31260276 CCCAGACAGGCTGGCCAGGGAAG 0: 1
1: 0
2: 3
3: 35
4: 325
Right 1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG 0: 1
1: 0
2: 3
3: 14
4: 148
1136597319_1136597322 -10 Left 1136597319 16:31260277-31260299 CCTGGATGAATGACCACATTCAT 0: 1
1: 0
2: 2
3: 6
4: 183
Right 1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG 0: 1
1: 0
2: 3
3: 14
4: 148
1136597318_1136597322 -1 Left 1136597318 16:31260268-31260290 CCAGGGAAGCCTGGATGAATGAC 0: 1
1: 0
2: 1
3: 13
4: 169
Right 1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG 0: 1
1: 0
2: 3
3: 14
4: 148
1136597316_1136597322 12 Left 1136597316 16:31260255-31260277 CCAGACAGGCTGGCCAGGGAAGC 0: 1
1: 1
2: 2
3: 32
4: 263
Right 1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG 0: 1
1: 0
2: 3
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136597322 Original CRISPR CCACATTCATGGACTGTGCA AGG Intronic
900702725 1:4058262-4058284 CCACCTTCCTGGACAGTGGAGGG + Intergenic
900844622 1:5086995-5087017 CCACACCCAGGGACTGAGCAAGG - Intergenic
902417643 1:16250930-16250952 CAACATTTAGGGACTGTGGAGGG + Exonic
902447067 1:16474252-16474274 CCACACTCCTGCACAGTGCAGGG + Intergenic
904920667 1:34005486-34005508 CCACATTCAAGGCCTGGGCGTGG - Intronic
905758738 1:40535337-40535359 CCATATTCATGGGTTTTGCATGG + Intronic
909398236 1:75194707-75194729 ACACATTCATTGCCTGTGTAAGG + Intergenic
909977741 1:82064999-82065021 CCACAAACATGCACTGAGCATGG - Intergenic
911410225 1:97494945-97494967 CCATCTTCAGAGACTGTGCATGG + Intronic
912776069 1:112507348-112507370 CCACATGCCAGGACTGTGCTAGG - Intronic
913172258 1:116243614-116243636 CCCCGTGCAGGGACTGTGCAAGG - Intergenic
915840355 1:159208144-159208166 ACACATTCATGAACTGTGGTTGG - Intergenic
916059792 1:161090376-161090398 CCACATGTCTGGACTTTGCAAGG + Intergenic
918556456 1:185805894-185805916 CCACATTCATGGTTAGGGCATGG + Intronic
919351713 1:196464818-196464840 GCAGATTTATGGACAGTGCAAGG - Intronic
921432336 1:215079999-215080021 CCACATTCATGTAGGGTGCTTGG - Intronic
922160363 1:223075028-223075050 GCACAGTCATGGGCTGTGCAGGG + Intergenic
922561715 1:226574603-226574625 CCAAATTCATGGCCTGAGCATGG + Intronic
923914971 1:238491893-238491915 CCACATCCATGGGCTCTGCAAGG + Intergenic
924070504 1:240273616-240273638 ACACATTCATGTTCTGTGTATGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1064272892 10:13880973-13880995 CCACATTCCTGGAATGTTCAAGG + Intronic
1065136474 10:22675728-22675750 GCTCATTCATGGACTGTGTCAGG - Intronic
1065628334 10:27653616-27653638 CCACAACCAGGGACTCTGCAAGG - Intergenic
1069588326 10:69625632-69625654 CAACATTCATAGGCTGGGCATGG + Intergenic
1069883059 10:71606019-71606041 CCACAGCAATGCACTGTGCATGG - Intronic
1070218406 10:74412429-74412451 GAACATTCATGGGCTGGGCATGG - Intronic
1070810101 10:79293305-79293327 CCACATGCATTGAAAGTGCAGGG - Intronic
1072788422 10:98300582-98300604 CCACACTCATGGAGAGAGCAGGG + Intergenic
1073077246 10:100831835-100831857 CCAAATTGATGGAGTGGGCAGGG - Intergenic
1074790343 10:116880296-116880318 TAACTTTCATGGGCTGTGCAGGG - Intronic
1077037612 11:502920-502942 CCATATTCAGGGCCTGTGCCTGG - Exonic
1080910452 11:36592785-36592807 CCAGATCCATGCACTGAGCATGG + Exonic
1081073153 11:38634953-38634975 TCACATTTATGGACTGACCAGGG + Intergenic
1081077355 11:38693508-38693530 ACACATGCATTGGCTGTGCAAGG - Intergenic
1084939670 11:72605808-72605830 ACACATTCAGGGAGTGGGCAGGG + Intronic
1085239012 11:75036437-75036459 CCACATGTATGGTCTGTGCTGGG - Intergenic
1085442511 11:76577465-76577487 CCACATTCCTGGGCTGTGACTGG - Intergenic
1085807139 11:79646760-79646782 CAACATTCACGGTCTGTCCAGGG - Intergenic
1086161606 11:83727950-83727972 CCAAATTCATGGATTTTACAGGG + Intronic
1087113571 11:94498243-94498265 CCACTTACAAGCACTGTGCAGGG - Exonic
1089212212 11:116813058-116813080 CCACATGCAGGCACTGTGCTAGG + Intergenic
1089325993 11:117657402-117657424 CCACATTCATTTACTGGCCAGGG - Intronic
1093442816 12:19219166-19219188 TCACATACATGGGCTCTGCAAGG + Intronic
1094327032 12:29251768-29251790 CCACCATCACGGATTGTGCAAGG + Intronic
1094559262 12:31535164-31535186 CCACTTGCAAGTACTGTGCAGGG + Intronic
1096843331 12:54391728-54391750 CCAGAGTAATGGACTGAGCAGGG + Intergenic
1097643765 12:62211741-62211763 ATACATTCATGCACTGTGCTTGG - Intronic
1097984366 12:65768142-65768164 CCACAGCCATGGACCTTGCATGG + Intergenic
1104634179 12:130427405-130427427 CCGCATTCATGTGCTCTGCAGGG - Intronic
1104874959 12:132027261-132027283 GCACATGCCTGGAATGTGCATGG - Intronic
1106383055 13:29258495-29258517 CCACAGTCTTGGATTCTGCAGGG + Intronic
1107096747 13:36545624-36545646 ACACCTTCAAGGACTGTGTAAGG + Intergenic
1107247073 13:38309427-38309449 GCAGAGTCAAGGACTGTGCATGG + Intergenic
1108505550 13:51109301-51109323 CAACATTAATGGAGTTTGCACGG + Intergenic
1109908498 13:68877004-68877026 CCACATTTATGGGCCGGGCACGG - Intergenic
1111052815 13:82907500-82907522 CCTCATACATGGAATTTGCATGG + Intergenic
1114412263 14:22512212-22512234 CCACATCCATGGACTGTGGAAGG + Intergenic
1118965493 14:70579886-70579908 CCACACTCATGGATTGGCCAAGG + Intergenic
1118966850 14:70595092-70595114 CAACATCCATGGGCTCTGCAAGG + Intronic
1119473264 14:74912191-74912213 CTACATCCCTGCACTGTGCAGGG - Intronic
1125503742 15:40254839-40254861 CCACATGGATAGACTGTGCTAGG - Intronic
1127912337 15:63427828-63427850 CCACAGCCAGGGACTGAGCAAGG + Intergenic
1128554679 15:68623399-68623421 CCACATGCATGGACACTGCCAGG - Intronic
1133080741 16:3317708-3317730 CCACATTCATGACATGTGAAGGG - Exonic
1136597322 16:31260290-31260312 CCACATTCATGGACTGTGCAAGG + Intronic
1138056662 16:53841540-53841562 CCAAGTTCATGGTCTCTGCAAGG - Intronic
1141472782 16:84251013-84251035 CCACAATCATGCTCTGTCCATGG - Intergenic
1144593692 17:16546893-16546915 CCCCATTCATACACAGTGCAGGG + Intergenic
1148522005 17:48285920-48285942 CCACATTGATGAAATGGGCATGG + Intronic
1149991854 17:61387869-61387891 CCACATCCCTGGAGAGTGCAAGG + Intronic
1156194837 18:34762684-34762706 ACACATACATTGATTGTGCACGG + Intronic
1157490955 18:48123424-48123446 GCACATTCAGCGACTATGCAGGG + Intronic
1157750787 18:50176246-50176268 CCACGGTCATGGGCAGTGCAAGG - Intronic
1158023550 18:52870175-52870197 CCACCTGCAGGGAGTGTGCAAGG - Intronic
1159249518 18:65856097-65856119 TCACATTGATGGCATGTGCATGG - Intronic
1159919513 18:74214973-74214995 CCTGATTCATGGGCAGTGCAAGG - Intergenic
1160029478 18:75246221-75246243 CCAGATGCATGCACTGTTCAGGG + Intronic
1160891661 19:1381881-1381903 TCACACTCATGAACTGGGCATGG + Intergenic
1162209621 19:9080985-9081007 CCAGAATCATGGACTCTCCATGG + Intergenic
1167840680 19:52115920-52115942 CCACATTCATTGCATTTGCAAGG + Exonic
925031257 2:651421-651443 CCTCATGCATGGGCTCTGCATGG + Intergenic
925152629 2:1625612-1625634 CCACATTCCTGGCCTCTGCAAGG + Intergenic
925271982 2:2616544-2616566 CCACCTTTGTGGACTGTGCCCGG - Intergenic
925386440 2:3465050-3465072 CGACATTCACGCACTCTGCAAGG + Intronic
925953626 2:8939264-8939286 CCACATCCATGTCCTGTGCCTGG + Intronic
926272917 2:11380073-11380095 CTCCATTCATGGTCTGTGGATGG + Intergenic
926339962 2:11896900-11896922 GTACATTCAGGGACTCTGCAAGG - Intergenic
932916936 2:75869480-75869502 CCACATTCATGTACTATTGAAGG - Intergenic
935348095 2:102127248-102127270 GCACATTCATGGACAGTGCATGG + Intronic
937536238 2:122891417-122891439 CCACATGCATGCACTGAGAAAGG + Intergenic
937766022 2:125661435-125661457 TTACATTCATAGACTGTGTAAGG + Intergenic
938201022 2:129373222-129373244 CCACAGTTATGCACTGTGGAAGG - Intergenic
938230137 2:129651293-129651315 CCACATTCCTTGGCTGTGGAAGG - Intergenic
942111578 2:172687985-172688007 CCACAATTCTGGACTTTGCAGGG - Intergenic
944149601 2:196544021-196544043 CCACATTCCAGGACTCTGCTAGG + Intronic
947308434 2:228773817-228773839 CCACATTCATGCAAAGTCCATGG + Intergenic
947386129 2:229592282-229592304 CCACATTCTGGACCTGTGCAAGG + Intronic
1173530028 20:43762205-43762227 CCACATTTGGGGCCTGTGCAGGG - Intergenic
1173932521 20:46832702-46832724 GAACATTCATGAACTGTGCAGGG - Intergenic
1174349582 20:49957282-49957304 CGACATCCATGGGCTCTGCAAGG + Intergenic
1175670859 20:60901665-60901687 CCCCTTGCATAGACTGTGCATGG - Intergenic
1176216040 20:63948243-63948265 CCACAGTCACTGTCTGTGCAGGG + Intronic
1176304600 21:5116681-5116703 CCACATTTATGGACCATGAAAGG - Exonic
1178462433 21:32815290-32815312 CCACACACATGCACTGTGCCAGG + Intergenic
1179003672 21:37488840-37488862 TCACAATCATGGTCTGTGGATGG - Intronic
1179852454 21:44145349-44145371 CCACATTTATGGACCATGAAAGG + Exonic
1180887577 22:19258061-19258083 CGACATCCATGGGCTCTGCAAGG + Intronic
1181616618 22:24059346-24059368 CCACATTCATGGAATCTGGTAGG + Exonic
1181964890 22:26649537-26649559 GCACATGCTTGGTCTGTGCAAGG + Intergenic
1183088821 22:35507302-35507324 ACACATTCATGAGCTGGGCACGG - Intergenic
1183617311 22:38953650-38953672 TCACATGCATGGACTGTCCAGGG + Intronic
1184448344 22:44567499-44567521 CAACATCCATGGACTCTGTAAGG + Intergenic
1184571914 22:45330644-45330666 CCACATTCACGGCCTCTACACGG + Exonic
957459658 3:80500144-80500166 CAACATTCATGGCATGTGCAGGG + Intergenic
958435157 3:94087464-94087486 CCACATTGATGGACTCACCATGG + Intronic
974786996 4:66631344-66631366 CAACATTCATAGTCTGTGCAGGG - Intergenic
978759657 4:112343033-112343055 CCACTTGCTTGGACTGTGTAGGG - Intronic
980478536 4:133354141-133354163 CTCAATTCATGGACTGTGAAAGG + Intergenic
984878948 4:184393541-184393563 TCACATTCATGGGCGGTGCAAGG - Intronic
985965049 5:3333186-3333208 CCACGTTCATGGACTGTGTGTGG + Intergenic
988077087 5:26367128-26367150 CAGCAGTCATGGACTGGGCAGGG + Intergenic
989031725 5:37126337-37126359 CCAAATTAATGGACTAAGCATGG + Intronic
991156033 5:63436730-63436752 CCACTTTAATGCACTGTGGATGG + Intergenic
992242809 5:74788781-74788803 CCACCATCAAGGACGGTGCAGGG + Intronic
993746920 5:91611781-91611803 CTACATGCATGGAATGTGCAGGG - Intergenic
997153364 5:131524356-131524378 ACAGCTTCATGGACAGTGCAAGG - Intronic
998775198 5:145591980-145592002 GCACATTCATGGATAGTGTATGG - Intronic
1000742075 5:164981277-164981299 CCAAATCCATGGACTATGAAAGG - Intergenic
1001631656 5:173179847-173179869 TCACATTCTTGGAATGTGCTAGG - Intergenic
1001752202 5:174140252-174140274 CCCCACTCATGGACTGAGCGAGG + Intronic
1002283729 5:178148618-178148640 CCACACACAGGGACTGGGCACGG + Exonic
1003955218 6:11157319-11157341 CTACATTAATGGAATGGGCAAGG + Intergenic
1005224121 6:23621294-23621316 CATTATTCATGGGCTGTGCAAGG - Intergenic
1005560475 6:27035267-27035289 CCACATTGAGGAACTGGGCATGG - Intergenic
1005563498 6:27065439-27065461 CCACAGTTATGGGCTGTGAAAGG + Intergenic
1006026409 6:31150003-31150025 CCACCTTCATGGAAGGAGCAAGG + Intronic
1008442184 6:51544238-51544260 CAACACTCATGAACTGAGCAAGG - Intergenic
1012168770 6:95991602-95991624 CCACATTCATGGGCTCAGGAAGG + Intergenic
1015041403 6:128724586-128724608 CCAAATTCAGGGACTTTGGAGGG + Intergenic
1017173257 6:151477590-151477612 TCACATTCTTGGCCTGGGCACGG - Intergenic
1017446565 6:154511610-154511632 CCACATTCATGGACTGCAACTGG + Intergenic
1018885641 6:167933961-167933983 CCAGAGTCCTGGCCTGTGCAGGG - Intronic
1019205994 6:170362401-170362423 CCACATTCCTAGACAGTACATGG - Intronic
1024333845 7:48183588-48183610 CCTCATTCAGGGATTGTGTACGG + Intronic
1026863989 7:73811266-73811288 CCTGATTCCTGGACTGGGCACGG - Intronic
1031643913 7:124200258-124200280 CCAGTTCCATGGACTGTGCGTGG - Intergenic
1032640648 7:133763350-133763372 CCTAAGTCATGGACTGTGCTAGG - Intronic
1032734271 7:134676518-134676540 TTACATTCATCTACTGTGCAAGG - Intronic
1034901810 7:154912531-154912553 CCACATTCTTGTAGTGTGCAAGG - Intergenic
1035015268 7:155760335-155760357 GCAAATGCATGGACTGTGGAAGG - Intronic
1038479185 8:27890030-27890052 CCACATTCCAGGATTGTGCTAGG + Intronic
1039866768 8:41511776-41511798 CAACATCCATGGGCTCTGCAAGG + Intergenic
1045964722 8:108011713-108011735 CCACATGCATGGAATGTACAAGG + Intronic
1046013309 8:108576183-108576205 CAACATTCATGGACTTTGCATGG + Intergenic
1048026430 8:130591484-130591506 CTACATGCATGGTCTGTGCCAGG - Intergenic
1051372297 9:16368927-16368949 CCACATTTGTTGACTGTTCAAGG - Intergenic
1051998920 9:23252684-23252706 CCACTTTCATGTCCTTTGCAGGG + Intergenic
1052452179 9:28645289-28645311 CAACCTTCATGGACTGTGATAGG + Intronic
1052613002 9:30800191-30800213 CGACATCCATGGGCTCTGCAAGG - Intergenic
1053174047 9:35909707-35909729 CCACGGTCATGGACAGGGCAGGG + Intergenic
1186967455 X:14803391-14803413 CCACAGGCATGTACTGTGCTGGG + Intergenic
1187809092 X:23155811-23155833 TCACCTTCAAGGACTGTGAAAGG + Intergenic
1193041096 X:77004613-77004635 CCACATCCATGGCCCATGCAGGG + Intergenic
1197612518 X:128655068-128655090 CCACATTCAGGGACAGTGTTGGG - Intergenic
1200085881 X:153604788-153604810 CAACATCCATGGGCTTTGCAAGG - Intergenic