ID: 1136598520

View in Genome Browser
Species Human (GRCh38)
Location 16:31268171-31268193
Sequence CCCTAGGTGGAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 345}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136598520_1136598528 -9 Left 1136598520 16:31268171-31268193 CCAGCTTCCCTCTCCACCTAGGG 0: 1
1: 0
2: 0
3: 37
4: 345
Right 1136598528 16:31268185-31268207 CACCTAGGGGCACTGGGTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 137
1136598520_1136598529 -8 Left 1136598520 16:31268171-31268193 CCAGCTTCCCTCTCCACCTAGGG 0: 1
1: 0
2: 0
3: 37
4: 345
Right 1136598529 16:31268186-31268208 ACCTAGGGGCACTGGGTTCTGGG 0: 1
1: 0
2: 1
3: 8
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136598520 Original CRISPR CCCTAGGTGGAGAGGGAAGC TGG (reversed) Intronic
900165911 1:1244274-1244296 CGCTGGGGGGAGAGAGAAGCAGG + Exonic
900189086 1:1345763-1345785 CCCAAGGCGGAGCAGGAAGCTGG + Intronic
900555971 1:3280750-3280772 TCCTAGGTGAAGTGAGAAGCAGG + Intronic
900614958 1:3561302-3561324 CCCAAGCTGGAGAGGGACTCAGG + Intronic
900627222 1:3613966-3613988 CCCCAGGTGGAGAGGCAGGCAGG + Intergenic
902210430 1:14900827-14900849 CACCAGGAGGAGAGGGATGCTGG + Intronic
902279275 1:15362519-15362541 CACAAGGTGGAGAGGGCTGCAGG + Intronic
902444225 1:16451906-16451928 CCCCTGGGGGAGGGGGAAGCAGG - Exonic
902534697 1:17112718-17112740 CACCAGGTGGTGAGGGAAGCTGG - Intronic
902767179 1:18625093-18625115 CCCCAGGGAGAGAAGGAAGCAGG + Intergenic
903083945 1:20837980-20838002 CTCTAGCTGCAGACGGAAGCAGG + Intronic
903129351 1:21268627-21268649 CTCTAGGCGGAGAGGGGAGAAGG - Intronic
903177142 1:21587926-21587948 CCTTTGCTGGAGATGGAAGCTGG - Intergenic
903854442 1:26328474-26328496 CCCAGGGCGGAGAGGGAGGCTGG + Intronic
903879783 1:26500821-26500843 CCCGAGGTGGAGAGGGCCCCGGG - Intergenic
904456380 1:30650620-30650642 CCCCAGGTGGGGAGAGAAGAGGG - Intergenic
905008088 1:34727300-34727322 ACCTAGATGCAGAAGGAAGCTGG - Intronic
905582171 1:39090525-39090547 CCCCAGTTGGTGAGGGAAGGTGG + Intronic
906191793 1:43903655-43903677 CCCTGGGAGGAGAGGGAGGAGGG + Intronic
906318668 1:44803734-44803756 CCCTAGCAGCTGAGGGAAGCCGG + Intronic
908159603 1:61393611-61393633 CCATGGGTGGACAGGGAAGCCGG - Intronic
911154475 1:94624936-94624958 CCCAAGGAGGAGAGCGAAGCAGG + Intergenic
911668689 1:100584318-100584340 TCATAGGTGGAGATGGAAGAGGG + Intergenic
913185028 1:116363066-116363088 CCCTTGCTGGATAGGGATGCAGG - Intergenic
913486563 1:119337092-119337114 GCTTGGGTGGGGAGGGAAGCTGG - Intergenic
913610557 1:120505855-120505877 CCCTTGGAGGAGAGTGAGGCTGG + Intergenic
914580633 1:149016384-149016406 CCCTTGGAGGAGAGTGAGGCTGG - Exonic
914854465 1:151341115-151341137 CAATAGGGTGAGAGGGAAGCAGG + Exonic
914902322 1:151717257-151717279 ATATAGATGGAGAGGGAAGCAGG + Intronic
914905856 1:151743094-151743116 CTCTTGGTGGAGAGGGAGCCTGG - Intergenic
915164301 1:153940126-153940148 GCCTGGGTGGGGAGGGAGGCTGG - Intronic
915524517 1:156467720-156467742 CCCTATGGGGAGAGGGGAGTGGG - Intronic
917625937 1:176846378-176846400 CCCTAACAGAAGAGGGAAGCTGG + Intergenic
920169477 1:204061927-204061949 CCCTAAGTGGAGGAGGAGGCTGG - Intergenic
920183583 1:204147254-204147276 GCCAAGGTGGGGAGGGAAACAGG + Intronic
920191947 1:204199257-204199279 CCCTAGGAGCAGAGGGGAGAAGG + Exonic
920285315 1:204874647-204874669 GCCTAGGTGGGGAGGGTAGAAGG - Intronic
920542094 1:206786487-206786509 TTCTTGGTGGAGTGGGAAGCAGG + Intergenic
922381119 1:225027571-225027593 CAGAAGGTGAAGAGGGAAGCAGG + Intronic
922913828 1:229239547-229239569 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
923387907 1:233483961-233483983 CACTGGGTGGAGAGGGATGTGGG - Intergenic
923522099 1:234743080-234743102 CCCTAGCAAGAGAGAGAAGCAGG - Intergenic
923532797 1:234824942-234824964 GCCCAGGAGGAAAGGGAAGCGGG - Intergenic
924143535 1:241050353-241050375 CCTCAGGTGGAAAGGGAAACAGG + Intronic
1062945543 10:1458576-1458598 CCCCAAGTGGAGAAGGAAGAAGG - Intronic
1063360070 10:5446451-5446473 GCCCAGGAGGAGAGTGAAGCTGG - Intronic
1064926903 10:20579559-20579581 CGCTAGGTGGAAATGGGAGCTGG - Intergenic
1065796230 10:29310968-29310990 CCTGAGGATGAGAGGGAAGCAGG - Exonic
1066277547 10:33883839-33883861 CCTTAGGTGCAGAGCCAAGCAGG + Intergenic
1067226212 10:44377832-44377854 CCCTGGGAGGAGAGGGATGCAGG + Exonic
1069572841 10:69504797-69504819 CCCCAGGGGCAGAGGCAAGCTGG - Intronic
1070204473 10:74242903-74242925 CTCTCAGTGGAGAGGGGAGCTGG - Intronic
1070560083 10:77559576-77559598 CCCTAGCTAGAGAGGAGAGCTGG - Intronic
1071004217 10:80863904-80863926 CCTAAGCTGGAGAGGGAAACTGG - Intergenic
1072197207 10:93126418-93126440 ACCTAGATGGAGAGTGAAGTTGG + Intergenic
1072553701 10:96498226-96498248 CGCTAGGCGGAGAGGGAAGGAGG + Intronic
1073329401 10:102660889-102660911 CCCTAGGCAGCCAGGGAAGCAGG + Intergenic
1075105009 10:119533373-119533395 ACCAAGGTGGAAGGGGAAGCAGG + Intronic
1075795932 10:125119369-125119391 CCCTAGGGGGAGAGTGGAGTGGG - Intronic
1076038332 10:127220580-127220602 CCCTAGCTGTAAAGGGAAGAAGG + Intronic
1076521511 10:131084290-131084312 CCCTAGCTGGACAGGCAGGCAGG - Intergenic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1078024209 11:7679423-7679445 CCCCATGTGTAGAGGGAAACAGG + Intergenic
1078884641 11:15488344-15488366 CCCTAGCTTCAGAGGGAGGCAGG - Intergenic
1079027375 11:16960120-16960142 CCTAAAGTGGAGAGTGAAGCCGG - Intronic
1079706885 11:23632547-23632569 CCCTAGGTGGTGAGGTTTGCAGG - Intergenic
1080258795 11:30323256-30323278 CCCTGGGTGGCGAGGGAGCCCGG + Intronic
1080578771 11:33623982-33624004 CCCTAGGTCAAGAGGGTAGGAGG - Intronic
1080604406 11:33852881-33852903 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1081406811 11:42707766-42707788 CCCTATGTGAAGAGAGATGCAGG + Intergenic
1082992950 11:59224223-59224245 CCCTCGGTTGAGCAGGAAGCAGG + Intergenic
1083072914 11:60005175-60005197 CAATATGTGGAGAGGGAAGACGG + Intergenic
1083237776 11:61362565-61362587 CCCTAGGTACAAAGGGAAGGCGG + Intronic
1083751737 11:64764750-64764772 CACTTCATGGAGAGGGAAGCGGG + Exonic
1083823587 11:65186076-65186098 CCCTAGGGGGAGCTGGAAGCTGG - Intronic
1083853256 11:65379783-65379805 ACCCTGCTGGAGAGGGAAGCTGG + Intronic
1084668622 11:70592210-70592232 CCCTGCGTGCAGAGGGAAGACGG - Intronic
1085201669 11:74705776-74705798 GCCTGGGTGGGGAGGGCAGCAGG + Intronic
1085257181 11:75181765-75181787 CCCTGGATGGAGAGGGCTGCTGG - Intronic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1088645527 11:111913507-111913529 CCCCAGCTGGGGAGGGCAGCAGG + Exonic
1089256882 11:117198918-117198940 CCCCAGGAGGAGAGGGTGGCTGG + Intergenic
1089317843 11:117604425-117604447 GCCTCGGTGGAGAGGGAGGGAGG - Intronic
1089495179 11:118904520-118904542 CCCTTGGTGCTGAGGGCAGCTGG - Intronic
1089872169 11:121685327-121685349 ACCCAGGTGGAGGTGGAAGCAGG + Intergenic
1090458320 11:126868427-126868449 CCCTAGGTGGAGAGCAAAGGAGG + Intronic
1090890350 11:130917552-130917574 CCCAAGGTGGACATGGAAGCTGG - Intergenic
1093592329 12:20917655-20917677 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1093731379 12:22569138-22569160 CTCTCAGTGGAGAGGGGAGCTGG - Intergenic
1094318027 12:29153490-29153512 CACCAGTTGGAGAGGGGAGCAGG + Intronic
1095973989 12:47926847-47926869 CCCTCTGTGGAGAGGAGAGCTGG - Intronic
1096215691 12:49796497-49796519 CCCTAGCTGGAGAGGGCAGAAGG + Exonic
1096799041 12:54097239-54097261 CCACAGGTGTAGAGGGAAGGAGG - Intergenic
1097137927 12:56875009-56875031 CCCTAGTTTCAGAGGGAGGCTGG + Intergenic
1097747848 12:63318825-63318847 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1101801883 12:108029498-108029520 GCCTAAGTGGACAGGGAAGGCGG + Intergenic
1102008375 12:109603093-109603115 CCCTAGGTCTGGAGGGAGGCAGG - Intergenic
1103261501 12:119593209-119593231 CCCCAGGTGGGGTGGGAACCAGG - Intergenic
1104339026 12:127930045-127930067 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1104979816 12:132568841-132568863 CCCCAGGTGAAGAGTGAAGATGG + Intronic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1113786960 13:113006961-113006983 CCCTTGGGGGAGAGGGTGGCAGG + Intronic
1114533436 14:23409276-23409298 CCCCAGGAGCAGAGGGTAGCAGG - Intergenic
1116423003 14:44755089-44755111 GCCTAAGTGCAGAAGGAAGCTGG + Intergenic
1116448497 14:45039036-45039058 CCCTAAGTGGAGAGGAGACCCGG + Intronic
1116716351 14:48431377-48431399 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1117547012 14:56801880-56801902 CCCTGGGTGGAAAGAGAAGCTGG + Exonic
1118024907 14:61759231-61759253 CCCTAGGAGTAGACTGAAGCTGG + Intergenic
1118240035 14:64047168-64047190 CTCTCAGTGGAGAGGGAAGCTGG + Intronic
1120153178 14:81060918-81060940 GCCTAGGTGGAGAGGCATACTGG + Intronic
1121408536 14:93733951-93733973 CCCTTGGTGGAGAGAGAAGGAGG - Intronic
1122778425 14:104133352-104133374 CCCTGGGGGAAGAGGGAAGGAGG + Intergenic
1122906054 14:104801991-104802013 CCCTCAGCGGAGAGGGCAGCCGG + Exonic
1202901778 14_GL000194v1_random:48023-48045 TGCTAGGTGGTGAGGGAATCTGG + Intergenic
1123685555 15:22794767-22794789 CCCTAGGTGGAGACGGAACGAGG + Intronic
1124466241 15:29942339-29942361 CACTAGGTGGAGATGAAGGCCGG + Intronic
1127785992 15:62355131-62355153 CACTGGGTGCAGAGTGAAGCAGG + Intergenic
1127927017 15:63556571-63556593 CCCTAGGTGTTGAGGGCAGCTGG + Intronic
1130045408 15:80440466-80440488 CACAGGGTGGAGAAGGAAGCTGG + Intronic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1132304371 15:100800868-100800890 CCATAGGAGGGTAGGGAAGCAGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133819897 16:9226764-9226786 ACCCAGGTGGAGGAGGAAGCAGG - Intergenic
1134211282 16:12279606-12279628 TCCCAAGTGGAGAGGGAAGCAGG + Intronic
1135382223 16:22004698-22004720 TCCTATGGGGAAAGGGAAGCAGG - Intergenic
1135400627 16:22164045-22164067 CCTCAGGTGGAGAGGGAGGTCGG + Intergenic
1136249666 16:28996026-28996048 CCCTGGGTGGAGGCGGAGGCAGG + Intergenic
1136598520 16:31268171-31268193 CCCTAGGTGGAGAGGGAAGCTGG - Intronic
1137053949 16:35734668-35734690 CCCTAGCTGGAAAGCTAAGCAGG + Intergenic
1137487004 16:48899805-48899827 CCCTTGGTGGGAAGGCAAGCTGG + Intergenic
1137618693 16:49861594-49861616 AGCTAGGTGGTGAGGGAAGCTGG - Intergenic
1137765239 16:50973029-50973051 CCCTAGGTGGTGAGGTCAGCAGG - Intergenic
1138848313 16:60594892-60594914 GTCTAGGTGGAGAAGCAAGCTGG - Intergenic
1139953198 16:70681692-70681714 CCCCAGGAGGGGAGGGGAGCAGG - Intronic
1140550096 16:75856275-75856297 CTCTCAGTGGAGAGGGAAGCTGG - Intergenic
1141191328 16:81827004-81827026 CCCTAGGGGAACAGGGAGGCTGG - Intronic
1141600702 16:85124381-85124403 CCCGAGGTGGGGCGGGCAGCGGG - Intergenic
1142414874 16:89935894-89935916 CCCTAGGGCGAGGGGAAAGCAGG - Exonic
1142671280 17:1488389-1488411 CCCCGGGCGGGGAGGGAAGCGGG + Intronic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1143517576 17:7427435-7427457 CTCAAGGTGGAGGTGGAAGCCGG - Exonic
1143674585 17:8422533-8422555 CCCTTCCAGGAGAGGGAAGCAGG - Intronic
1143685516 17:8511811-8511833 ACCTAGGGGGAGAAGGGAGCAGG - Intronic
1143706773 17:8703535-8703557 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1144675642 17:17159753-17159775 CCCTAAATGGAGAGTGAAACAGG - Intronic
1145250207 17:21293313-21293335 GCCTCGCTGGAGAGGGAAGGAGG - Intronic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1146549581 17:33768913-33768935 CTCTCAGAGGAGAGGGAAGCTGG - Intronic
1146555211 17:33817162-33817184 CTCTAGGTGGTGTGGGCAGCTGG + Intronic
1146608557 17:34284792-34284814 CCCTAGTTGGAGAGGGTATAAGG - Intergenic
1146686096 17:34842514-34842536 CCCTTGGTGGTGAGGGACTCAGG - Intergenic
1146944409 17:36864087-36864109 CCCTTGGTGGAGATGGATGGAGG + Intergenic
1147164495 17:38586209-38586231 CCCTTGGTGGGGAGGGGAGCTGG - Intronic
1148697943 17:49572376-49572398 TCCAAGGGTGAGAGGGAAGCAGG + Intergenic
1149575168 17:57706794-57706816 TGCAAGGTGGAGACGGAAGCAGG + Intergenic
1149656159 17:58310591-58310613 CCCTGGGTGGAGCTGGAGGCCGG + Exonic
1151018493 17:70584796-70584818 CCCTCAGTGGAGAGGGGAGCTGG + Intergenic
1151155946 17:72123104-72123126 CTCTGGGTAGAGAGGGGAGCGGG - Intronic
1151200239 17:72462617-72462639 CACGAGGAGGAGAGGGAGGCTGG - Intergenic
1151417240 17:73974367-73974389 CCCTAGGTGGCAATGGCAGCTGG - Intergenic
1151745599 17:76010125-76010147 ACCCAGGTGGAGAGGGACCCCGG - Exonic
1151783880 17:76265765-76265787 CCCCACGTGCAGAGGGGAGCCGG - Intronic
1152747672 17:82048836-82048858 CCGTGGGCGGAGAGAGAAGCGGG + Intronic
1152846860 17:82606029-82606051 GCCCAGGATGAGAGGGAAGCGGG - Intronic
1153230122 18:2927093-2927115 TCCCAGGAGGAGAAGGAAGCTGG - Intronic
1154384457 18:13880575-13880597 CTCTCAGTGGACAGGGAAGCTGG - Intergenic
1156000918 18:32382843-32382865 CCCTAGGTGGACAGAGAACTGGG + Intronic
1156534309 18:37848068-37848090 GCCCAAGTGGAGAGGGAAGTGGG - Intergenic
1156651666 18:39233512-39233534 CCCTCAGTGGAGAGGGGAGCTGG + Intergenic
1156997019 18:43481098-43481120 CTCTAGGTGGTGTGAGAAGCTGG + Intergenic
1157621597 18:49020386-49020408 CCCTGGGTGGAGAAGAAGGCCGG - Intergenic
1157865652 18:51181751-51181773 ACCTAGGGGGACAGGGAAGGAGG + Intronic
1161945764 19:7435527-7435549 CCCGAGGTGATGAGGGCAGCGGG + Intronic
1163284093 19:16335514-16335536 GCCTAGGTGGGGAGGGGAGCTGG - Intergenic
1163574864 19:18104721-18104743 ACTTAGGTGCAGAGGAAAGCCGG - Intronic
1164590837 19:29505985-29506007 CCCTAAGTGAGGAGGGTAGCAGG + Intergenic
1164831050 19:31321154-31321176 GCCTTGGTGGAAAGGGATGCTGG - Intronic
1165038983 19:33055442-33055464 TCCCAGGTGGAGAGGGAGGGAGG - Intronic
1165386128 19:35511653-35511675 GCCTGGGTGGAGAGGGAGGGAGG - Intronic
1165440318 19:35822608-35822630 ACCTAAGTGGGGAGGGAAACTGG + Intergenic
1166257744 19:41618581-41618603 GCCTGGGTGAAGAGGGCAGCAGG + Intronic
1167307869 19:48719492-48719514 TCCTGGGTGGAGAGGGGAACGGG + Intronic
1168061015 19:53892341-53892363 CCCTAGCTGGAGAGAGAGCCCGG + Intronic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
925581082 2:5411607-5411629 TCGTAGCTGGAGAGGAAAGCAGG - Intergenic
925887094 2:8402362-8402384 ACCTGGGTGGAGAGGGCAGGTGG - Intergenic
926123325 2:10256435-10256457 CCCAAGGTGGACAGGGACACAGG + Intergenic
927216226 2:20669187-20669209 CTCAGGGTGGAGAGGGAGGCCGG - Intronic
927289555 2:21392608-21392630 GGCTAAGGGGAGAGGGAAGCAGG - Intergenic
927484107 2:23477241-23477263 CCCCTGCTGCAGAGGGAAGCTGG - Intronic
927633642 2:24795507-24795529 CCCTTGGTGTAGAGGGAATCAGG + Intronic
927721744 2:25387569-25387591 CCCTAGGTAGAGAGGGCAGAGGG - Intronic
928329442 2:30346604-30346626 GCCTGGATGGAGGGGGAAGCAGG - Intergenic
928372453 2:30750491-30750513 GCCTAGGTGGAAAGGAAACCTGG + Intronic
931153249 2:59598522-59598544 CCCCACGTGTTGAGGGAAGCAGG - Intergenic
934504914 2:94882426-94882448 TGCTAGGTGGTGAGGGAATCTGG - Intergenic
934755811 2:96823847-96823869 CCCCAGGTGGAGGGGGCTGCCGG - Intronic
935735718 2:106105346-106105368 GCCAAGGTGGAGAGGCATGCAGG + Intronic
937002315 2:118479011-118479033 CCCTAGGAGGGGTGGGAATCAGG + Intergenic
937363078 2:121242535-121242557 CCCTGGGTGAGGTGGGAAGCAGG - Intronic
937390550 2:121482251-121482273 GTCCAGGTGCAGAGGGAAGCTGG - Intronic
939207924 2:139132022-139132044 TACTAGGTGGGGAGGGAAGGAGG - Intergenic
939956354 2:148530655-148530677 AGCTGGGTGGAGAGAGAAGCTGG - Intergenic
940354348 2:152722173-152722195 CCCTAAGTGGAAAAGGAAGCAGG - Intronic
940913646 2:159230395-159230417 CCTGAGCTGGTGAGGGAAGCTGG - Exonic
941125252 2:161576621-161576643 CCCTAGGGGGAGCAGGAAGATGG - Intronic
942060125 2:172221518-172221540 CCCAATGTGGGGAGGGAAGGGGG + Intergenic
943430890 2:187800254-187800276 ACCTATGGGGAGAGGTAAGCTGG - Intergenic
944070134 2:195658058-195658080 CCTTAGGTGGAGAGCGATGTGGG + Intronic
945843436 2:214915207-214915229 ACGTTGGTGGAGAGGGAGGCAGG + Intergenic
947257372 2:228181252-228181274 CCCTAGGTGGAGCCAGGAGCCGG - Intronic
947535779 2:230939842-230939864 CCCTGGGTGGGGAGGGATGGTGG - Intronic
948376571 2:237524898-237524920 CTCCAGGAGGAGGGGGAAGCAGG + Intronic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948601193 2:239108281-239108303 CCCTAGAAGGAGACGGAAGCTGG + Intronic
1169044104 20:2521893-2521915 CCCTAGCGAGTGAGGGAAGCAGG + Intronic
1169143223 20:3237714-3237736 CCCTAGGGAGAAAGGGAAGCAGG + Intronic
1169263425 20:4153654-4153676 TCCTAGGAAGAGAGGGAGGCAGG + Intronic
1170632301 20:18075915-18075937 TCCAAAGTGGAGAGGGAAGAAGG - Intergenic
1171188263 20:23138906-23138928 CCCTGGGTAAGGAGGGAAGCCGG + Intergenic
1171892656 20:30729827-30729849 TGCTAGGTGGTGAGGGAATCTGG - Intergenic
1172208634 20:33182078-33182100 CCTTGGGTGGAGGGAGAAGCTGG - Intergenic
1172445532 20:34991210-34991232 CCCTGTCTGGAGGGGGAAGCAGG + Intronic
1172603268 20:36197997-36198019 CCCTTGGGGGAGGGGGAGGCGGG - Exonic
1172907995 20:38383593-38383615 CCCCAGGGAGAGAGGGCAGCTGG + Intergenic
1173054350 20:39596978-39597000 CCCTCAGTGTAGAGGGAACCTGG + Intergenic
1173639428 20:44590213-44590235 CACTTGGTGGAGAGGAAAGCTGG - Intronic
1173985732 20:47259972-47259994 CCCTAGGTGGAGAGGTCAATAGG - Intronic
1174128328 20:48325063-48325085 GCCTTGGTGGAGAGAGATGCCGG - Intergenic
1175065435 20:56282425-56282447 CCCCAGAAGGAGAGGGAGGCTGG - Intergenic
1176621146 21:9062790-9062812 TGCTAGGTGGTGAGGGAATCTGG + Intergenic
1178415861 21:32404630-32404652 CCAGAGGTGGGGAGGGAAGAGGG + Intergenic
1178427059 21:32487278-32487300 CCCAAGCTGGAGAGAGAGGCTGG + Intronic
1179634196 21:42696872-42696894 CCCCAGGTGGAGAGGGCACTCGG - Intronic
1180024103 21:45148836-45148858 GCATGGGTGGAGAGAGAAGCTGG - Intronic
1180233824 21:46444266-46444288 CTCTGGGTGGAGAGGGAAAAGGG + Intronic
1181149773 22:20874935-20874957 CCCTTGGAGGAGTGGGAAGCTGG + Intronic
1181552037 22:23645365-23645387 CCACAGGTGGGGAGGGAAGGAGG - Intergenic
1182477320 22:30583220-30583242 CCCCAGGGGGAGAGGGAACAGGG + Intronic
1183197121 22:36361166-36361188 CCTGAGGTGGAAAGGGAAGGGGG - Intronic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1184061098 22:42082081-42082103 CCCTAGATGGAGCAGGAAGCAGG + Intronic
1184165816 22:42727012-42727034 GCCCAGGTGGGGATGGAAGCAGG - Intergenic
1184390518 22:44200841-44200863 GCCTAGGTGGAGGGGGAGTCTGG - Intronic
1185388858 22:50548408-50548430 GCCTAAGAGGAGAGGGAACCAGG + Exonic
950023694 3:9806651-9806673 CCCCAGGTGGGGAGGGAGGGAGG + Intronic
950117885 3:10463224-10463246 GCCTAGTTGGGGAGGCAAGCTGG - Intronic
950122750 3:10492678-10492700 CCCCAGAGGGAGAAGGAAGCGGG - Intronic
950226687 3:11241407-11241429 CCCTGGGTGGAGTGGGAACTTGG + Intronic
950254472 3:11493161-11493183 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
950390637 3:12693908-12693930 CCTAAGGTGGAGGGAGAAGCAGG + Intergenic
953415355 3:42712497-42712519 AGCCAGGTGCAGAGGGAAGCTGG - Intronic
954073362 3:48159138-48159160 CCCTAGGCAGAGAGGAAACCAGG - Intronic
956301274 3:67775163-67775185 CTCTTAGTGGAGAGGGGAGCTGG + Intergenic
957161348 3:76613577-76613599 CCCTAAGTGCAGAGAGAAGACGG + Intronic
957193604 3:77040083-77040105 TCCTACGTGGTGAGGGAGGCAGG - Intronic
958973408 3:100638301-100638323 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
961467487 3:127090525-127090547 CCCTGGGTGGAGAGAGGAGAGGG - Intergenic
961522227 3:127473439-127473461 CCGGAGGTGGAGAGCAAAGCTGG + Intergenic
961650751 3:128415663-128415685 CCCGAGGTTGAGGGAGAAGCGGG - Intergenic
962844796 3:139264745-139264767 AGGTAAGTGGAGAGGGAAGCAGG - Intronic
963092151 3:141493336-141493358 ACCTAGGTGGAGATTGAACCTGG + Intronic
963842235 3:150119609-150119631 TCAAAGGTGGAGAGGGAAGGTGG - Intergenic
964724113 3:159796334-159796356 AGCTAGGGGGAGAGGGAAGGGGG + Intronic
965216296 3:165868574-165868596 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
966571374 3:181447459-181447481 CTCTAGGTGGAGAGAGTAGAAGG + Intergenic
967551011 3:190796193-190796215 CCCTCAGTGGAGAGGTATGCAGG - Intergenic
967634047 3:191779422-191779444 ACCATGGTGGAAAGGGAAGCAGG - Intergenic
968477923 4:821062-821084 TCCTACATGGGGAGGGAAGCAGG - Intronic
968699689 4:2048680-2048702 CCCCAGGTGGTCAGGGAAGAGGG - Intergenic
968913430 4:3486923-3486945 CCCGGGGAGCAGAGGGAAGCAGG + Intronic
969691261 4:8705407-8705429 GCCTGGGGAGAGAGGGAAGCTGG + Intergenic
969922911 4:10557527-10557549 CCCTAGATGCAGAGGGATGAGGG - Intronic
970016734 4:11520465-11520487 ACCTTGCTAGAGAGGGAAGCAGG - Intergenic
970510602 4:16777979-16778001 CCTGAGGTGGAGAGGGATGGGGG - Intronic
971231049 4:24800367-24800389 CTCTGGGTGGAGAGGGCTGCGGG - Exonic
973534497 4:51867574-51867596 CCCTCGGTGGAGAGGAGACCTGG + Intronic
974036400 4:56821788-56821810 CGGTAGGTGGCGAGGGAAGAGGG + Intergenic
975668913 4:76760614-76760636 CCCTAGGAGCAGAGGGTAACTGG + Intronic
976190387 4:82481210-82481232 AGCTGGGTGGAGAGAGAAGCAGG + Intergenic
978260109 4:106745848-106745870 CCCCAGGTGTAGAGGGATGGGGG + Intergenic
978919186 4:114161992-114162014 CCCCAGGCAGAGAGGGAAGAAGG + Intergenic
979559114 4:122082189-122082211 CCCTGGGTGGGAAGGGAAGGAGG - Intergenic
980627489 4:135391922-135391944 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
980985769 4:139692681-139692703 CCCTAGCTTGTGAGGGCAGCAGG + Intronic
982616643 4:157645267-157645289 CTCATGGTGGAGAGTGAAGCAGG - Intergenic
983172528 4:164552101-164552123 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
985151789 4:186954751-186954773 CCACAGATGGAGAGGGAAGTGGG + Intergenic
985548271 5:520741-520763 CCCTGGAAGGAGAGGGAGGCGGG - Intronic
985802456 5:2013625-2013647 CACGAGGGTGAGAGGGAAGCTGG + Intergenic
986371810 5:7087754-7087776 CCCTCGGTGGAGAGGGAAATTGG - Intergenic
987887142 5:23827450-23827472 GCCTAGACGGAGAGGGAAGTTGG - Intergenic
989713338 5:44428174-44428196 TTCTAGTTGGAGAGGGAACCTGG - Intergenic
990223019 5:53617046-53617068 CCCTTGGTGGAGAAGGGGGCAGG - Intronic
991088002 5:62665932-62665954 AACTAGGTGGACAGGGAAACAGG - Intergenic
992869248 5:80990031-80990053 GCCAAGGTGGAGAGGGCAGATGG + Intronic
993513616 5:88801821-88801843 CACTTGGTGAAGAGGGAATCTGG - Intronic
994775270 5:104031319-104031341 CTCTCGGTGGGAAGGGAAGCTGG - Intergenic
995241237 5:109887146-109887168 CCCAAGGTGGAAAAGCAAGCGGG + Intergenic
995778065 5:115746532-115746554 CCCTTGGTGGAGAGGTTTGCAGG + Intergenic
995989827 5:118223932-118223954 CCCTATGTGTCGAGGGAAGTGGG - Intergenic
998808009 5:145937578-145937600 GCCTATGTGGACAGGAAAGCAGG - Intronic
999267033 5:150273158-150273180 CCCTAGGAGGACAGAGAAGGTGG + Exonic
1001089384 5:168726331-168726353 ATATAGGTGGAGAGGGAGGCAGG + Intronic
1002602772 5:180363428-180363450 TCCCCAGTGGAGAGGGAAGCAGG - Intergenic
1002716422 5:181230975-181230997 CCCTAGGTGCTGAGGAGAGCGGG + Intronic
1004101977 6:12621991-12622013 CCCTACGTGTCGAGGGAAGCAGG - Intergenic
1004609125 6:17222431-17222453 ACCAGGGTGGAGGGGGAAGCAGG - Intergenic
1006058930 6:31404902-31404924 CCCAAGGTGGAGAGGGGCGGAGG - Intronic
1006071414 6:31499787-31499809 CCCAAGGTGGAGAGGGGCGGAGG - Intronic
1006177317 6:32130200-32130222 CCCCACGCGGAGAGGGCAGCCGG + Exonic
1006178981 6:32142403-32142425 ACATAGGGCGAGAGGGAAGCAGG + Intergenic
1006923945 6:37644000-37644022 GCCTAGGCAGAGAGGGAATCAGG - Intronic
1006932520 6:37696715-37696737 GCCAAGGTGGAGCGGGACGCGGG + Intronic
1010556156 6:77281947-77281969 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1011227860 6:85127409-85127431 AGCAAGGTGGAGAGGGAGGCAGG + Intergenic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1013967498 6:115972299-115972321 TACTAGGAGGAGAGAGAAGCTGG + Intronic
1014740507 6:125143440-125143462 CTCTCAGTGGAGAGGGGAGCTGG + Intronic
1015919265 6:138250401-138250423 TTCTAGGAGGAGAGAGAAGCAGG - Intronic
1016201587 6:141416914-141416936 CCCTACGTGCAGAGTGAAGCAGG + Intergenic
1016205773 6:141466743-141466765 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1016206482 6:141473473-141473495 CTCTCAGTGGAGAGGGCAGCTGG + Intergenic
1018812764 6:167309284-167309306 CACTAGGAAGAGAAGGAAGCTGG + Intronic
1018986012 6:168637840-168637862 CCCTACGGGGAAGGGGAAGCTGG + Intronic
1020093950 7:5357271-5357293 CTTTAGCTGGAGAGGGAAGGTGG + Exonic
1024480332 7:49855784-49855806 CCCTGGCTGGTGAGGGCAGCTGG - Intronic
1024532034 7:50401282-50401304 CCCTGGGTGGAGGGAGACGCCGG + Exonic
1026918708 7:74139429-74139451 CTCTCAGTGGAGAGGGGAGCTGG - Intergenic
1027164583 7:75825410-75825432 TCCCAGGTGGAAAAGGAAGCAGG + Intergenic
1027683166 7:81245843-81245865 CTCTAGGTGGGAAGGGAAGTGGG + Intergenic
1028018650 7:85744517-85744539 CCTTAGGTGTGGAGGGAAGTGGG + Intergenic
1029494040 7:100887682-100887704 CCCTGGGTGGAGAGAGGAGAGGG - Exonic
1029595496 7:101535535-101535557 CCCTTGGTGGAGAGGGTGTCAGG - Intronic
1030787864 7:113684694-113684716 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1034414505 7:150957501-150957523 CCCTAGGTGGAGAGGCAGCGTGG + Exonic
1035076391 7:156180370-156180392 CCCAGGGTAGAGAGGGAATCAGG + Intergenic
1035223168 7:157418766-157418788 CCCCAGGAGGAGAAGGGAGCTGG + Intergenic
1036621258 8:10425561-10425583 GCCTAGGAGGACAGGGAAGAGGG + Intronic
1038215975 8:25562074-25562096 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1038767497 8:30442656-30442678 CTCTAGGTGCAGGCGGAAGCTGG + Intronic
1039469063 8:37802531-37802553 CCCTGGGTGGGGAGGGGAGTGGG - Intronic
1039892208 8:41693365-41693387 CCCTAGGAGGAGGGGCATGCAGG - Intronic
1040080641 8:43281199-43281221 CAGAAGGTGGAGCGGGAAGCGGG - Intergenic
1040472516 8:47746513-47746535 CCAGAGGTTGAGAGGGAAGGAGG + Intergenic
1040549786 8:48429164-48429186 CCCCATGTGGACTGGGAAGCTGG - Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041819445 8:62013322-62013344 TACTAGGTGGACAAGGAAGCTGG - Intergenic
1042928709 8:73992784-73992806 CCAAAGGAGGAGAGGGAAGTGGG - Intronic
1043944195 8:86231367-86231389 CCCCAGGGGCAGAGGGAAGGAGG + Intronic
1047389295 8:124437149-124437171 TCCTGGCTGAAGAGGGAAGCAGG + Intergenic
1049575845 8:143389241-143389263 CCCTGTGAGGAGGGGGAAGCCGG - Intergenic
1049730296 8:144173939-144173961 CTCTTGGGGGAGAGGGGAGCTGG + Intronic
1049797815 8:144504583-144504605 CCCTGGGAGGGGAGGGGAGCAGG - Exonic
1051471458 9:17447447-17447469 ACCTAGGTGGAGAAGCACGCTGG - Intronic
1051996126 9:23219941-23219963 CTCTCAGTGGAGAGGGGAGCTGG + Intergenic
1054336919 9:63815990-63816012 AGCAAGGTGGAGAGGGAAGTAGG - Intergenic
1054356169 9:64065877-64065899 TGCTAGGTGGTGAGGGAATCTGG + Intergenic
1056059560 9:82870235-82870257 CTCTTAGTGGAGAGGGGAGCTGG - Intergenic
1058686723 9:107487359-107487381 CCCCGGGTGGGGATGGAAGCCGG + Exonic
1058719503 9:107750935-107750957 CCTTAGGTGGACAGCGAAGTGGG - Intergenic
1060515993 9:124266123-124266145 CCCAAGGTGGAGAGGCAGGTGGG + Intronic
1061191073 9:129083100-129083122 GCAGAGGTTGAGAGGGAAGCAGG + Intronic
1061265664 9:129503538-129503560 CCCCAGCTGGAGATGGAAGGAGG + Intergenic
1061383908 9:130276937-130276959 CCCCACTTGGAGAGAGAAGCAGG + Intergenic
1061880488 9:133566565-133566587 CCCTGGGTGGACAGGCAGGCGGG - Intronic
1062370150 9:136234670-136234692 CAGCAGGTGGAGACGGAAGCAGG + Intronic
1203744360 Un_GL000218v1:33259-33281 TGCTAGGTGGTGAGGGAATCTGG + Intergenic
1203565749 Un_KI270744v1:86224-86246 TGCTAGGTGGTGAGGGAATCTGG - Intergenic
1187592138 X:20729145-20729167 AGCTAGGTGGAGTGGAAAGCTGG + Intergenic
1189481102 X:41392987-41393009 CCATTGGAGGACAGGGAAGCTGG + Intergenic
1190055961 X:47181219-47181241 CCCAAGGTGGGGAGGGTACCTGG + Exonic
1190322022 X:49185110-49185132 GCGTAGATGGAGAGGGAACCGGG - Intronic
1190554136 X:51616677-51616699 CCCTAGGTGGAGAAGGACTGGGG + Intergenic
1190732073 X:53233060-53233082 CCCATGGTGGAGAGGGGAGAGGG + Exonic
1192193944 X:69016325-69016347 CGCTGGCTGGAGAGGGAAGGAGG - Intergenic
1192299425 X:69884305-69884327 GCCTAGGGGTAGAGGGAAGGTGG + Intronic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1195356192 X:104041939-104041961 CCCTTGGTCAAGAGGGAAACAGG + Exonic
1197199075 X:123733137-123733159 CGCTGGGTGGAGAGGAAAGTGGG - Intergenic
1199220664 X:145312195-145312217 CAATAGGTGAAGGGGGAAGCAGG + Intergenic
1199594490 X:149495860-149495882 CCCTTGGTGCAGAGGGAACTGGG - Intronic
1201157687 Y:11148246-11148268 TGCTAGGTGGTGAGGGAATCTGG + Intergenic