ID: 1136602722

View in Genome Browser
Species Human (GRCh38)
Location 16:31306215-31306237
Sequence TCATTAGGACACAAGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136602722_1136602726 14 Left 1136602722 16:31306215-31306237 CCTTTTTCCTTGTGTCCTAATGA 0: 1
1: 0
2: 0
3: 33
4: 312
Right 1136602726 16:31306252-31306274 GCTTCATAATTCTCTTAACAAGG 0: 1
1: 0
2: 3
3: 7
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136602722 Original CRISPR TCATTAGGACACAAGGAAAA AGG (reversed) Intronic
900724445 1:4206716-4206738 TGATGAGGACACAGAGAAAAGGG - Intergenic
901408192 1:9064295-9064317 GGATTAGGGCATAAGGAAAAGGG + Intronic
903254004 1:22079654-22079676 TCATTTGGAGACAAGATAAATGG + Intronic
906031205 1:42721529-42721551 TCATAAGGATACAAAAAAAATGG + Intergenic
906814008 1:48859119-48859141 TCATTGTGACAGAGGGAAAAGGG - Intronic
909789791 1:79661294-79661316 TAAGTATGACACAAGAAAAATGG - Intergenic
911353536 1:96786968-96786990 TCATAAGATCACAAGAAAAATGG - Intronic
912144051 1:106770214-106770236 TCATTATTTCTCAAGGAAAAGGG + Intergenic
912605553 1:110985376-110985398 TCAATACAACACCAGGAAAAGGG + Intergenic
913449332 1:118982483-118982505 ATATTAGGCCACAAGGAGAAAGG - Intronic
914748770 1:150518347-150518369 TGATTAGACTACAAGGAAAAAGG - Intergenic
919044440 1:192433085-192433107 TGATGAGGACACAGAGAAAAGGG + Intergenic
920110112 1:203581811-203581833 TAGTTAGGACACAGGGAAAGTGG - Intergenic
920848324 1:209611704-209611726 TCAAGAGGCCACAAGGCAAAGGG + Intronic
921171543 1:212554372-212554394 TAATTAGGACATAAGGAAACAGG - Intergenic
921353345 1:214260655-214260677 TAATTAGGAAACTAGGTAAAGGG - Intergenic
921700307 1:218261900-218261922 TTATTACAACACATGGAAAATGG - Intergenic
922448141 1:225714932-225714954 TAATAAGGACAGAAGGAAATTGG - Intergenic
923492361 1:234495243-234495265 TCATTTGGTCACAAGGAAGCAGG - Intergenic
924498457 1:244613013-244613035 ACATTAGGAAATAAGGAAATAGG + Intronic
1064871572 10:19943661-19943683 TCTTTAGGGTACAAGGGAAAAGG - Intronic
1065107185 10:22401613-22401635 TCATAAAGAGAAAAGGAAAAAGG + Intronic
1065635455 10:27728820-27728842 TCATTATGAGCCAAGAAAAATGG + Intronic
1065811242 10:29445734-29445756 CCATTAGGACACAGGGAGCATGG - Intergenic
1065908811 10:30283546-30283568 CCATTAGGACACAGGGAGCATGG - Intergenic
1066243443 10:33559870-33559892 TTATTGGGAGACAAGGAGAAAGG - Intergenic
1067265411 10:44737909-44737931 TCATAAGAAGACAAAGAAAATGG + Intergenic
1067541281 10:47156091-47156113 TCATTAGGATATAAGGATATAGG - Intergenic
1068144046 10:53043423-53043445 TCATCAGGACAGCGGGAAAAGGG - Intergenic
1068208995 10:53895811-53895833 AAATTAGGAGACAAGTAAAAAGG - Intronic
1069103326 10:64351519-64351541 TCATTCAGACAAAAGGACAATGG - Intergenic
1069542445 10:69305378-69305400 TTATTAGGACAAAGGGGAAATGG + Intronic
1070274809 10:74995521-74995543 TCATTTGTACACAAAGAAACAGG - Intronic
1073626339 10:105101689-105101711 TCATTTGGACACTTTGAAAAAGG - Intronic
1075829507 10:125394379-125394401 TGATTAGGACAAAAGAAAACAGG - Intergenic
1076089325 10:127667685-127667707 AAATAAGGACACAAGGAACAGGG + Intergenic
1079649109 11:22904417-22904439 TCATGAGGATGCAAAGAAAAGGG - Intergenic
1079776851 11:24542407-24542429 CCCTTAAGACACAAGAAAAAGGG + Intronic
1081501106 11:43667493-43667515 TTATTATGGCAGAAGGAAAAGGG - Intronic
1081540862 11:44033658-44033680 TGCTTGGGACACAAAGAAAAGGG - Intergenic
1081796678 11:45825360-45825382 TCAGGGGGACACAAGGAAACTGG - Intergenic
1083915153 11:65737981-65738003 TCATTGGGACATATGGAAGAAGG + Intergenic
1085790356 11:79492328-79492350 TGATTAACTCACAAGGAAAAGGG + Intergenic
1086516285 11:87617253-87617275 TCATGAGTAAACAAGGAAGAAGG + Intergenic
1087146264 11:94814645-94814667 TAATGGGGACACAAAGAAAAGGG + Intronic
1087705827 11:101491002-101491024 TCATTAGCACAGTAAGAAAATGG + Intronic
1088410291 11:109526452-109526474 TCATGATGACAGAAGGCAAAGGG - Intergenic
1089123106 11:116154736-116154758 ACATTAGGAAAGAAGGAAAAAGG + Intergenic
1090375038 11:126282699-126282721 TCATTTGTATAAAAGGAAAAAGG + Intergenic
1090638001 11:128704746-128704768 TCATGAGGACCCATGCAAAATGG - Intronic
1092192591 12:6531910-6531932 TCATTAGAAAACAAGGAGATTGG - Exonic
1094372715 12:29755280-29755302 TCATTAGAAGAGCAGGAAAAGGG + Intronic
1094420768 12:30268797-30268819 TTATAGGGACATAAGGAAAATGG - Intergenic
1095331605 12:40971949-40971971 TAATTAGGACATAAGCTAAAAGG + Intronic
1096719684 12:53511931-53511953 TTCTTAGGACAGAAGGAACAGGG - Intronic
1097686116 12:62692433-62692455 TCCTTAGTACAATAGGAAAATGG - Intronic
1098377247 12:69830020-69830042 TTATTAGGACAGAAGGAAGAGGG - Intronic
1098932410 12:76434868-76434890 TCACTAGGATGCAGGGAAAAAGG + Intronic
1099293334 12:80799676-80799698 TCCTTAGGAAACTAGAAAAAGGG + Intronic
1105602731 13:21901720-21901742 CCATTATGGCACAAGGAAATAGG + Intergenic
1107018126 13:35724983-35725005 TCATTATGCCAGAAGGAGAAGGG + Intergenic
1107835217 13:44407477-44407499 TGATGAGGAAACAAGGAAATGGG + Intergenic
1107893938 13:44939741-44939763 TTATCAGGAAACAAGAAAAATGG + Exonic
1108215998 13:48185329-48185351 TGTTTAAGACATAAGGAAAAAGG - Intergenic
1109100344 13:58176020-58176042 TGATGAGGACACACAGAAAATGG - Intergenic
1109813410 13:67546254-67546276 TCAATAAGATAAAAGGAAAATGG + Intergenic
1110644963 13:77871947-77871969 GCTTTAGGACATAAAGAAAAAGG + Intergenic
1111016295 13:82386725-82386747 TCTTTAGAACACAAGGTTAAAGG + Intergenic
1111773907 13:92634748-92634770 TCCTTAGGATCCAAGGGAAAGGG - Intronic
1111816434 13:93159786-93159808 TCATGAGGACACAAGCAACATGG + Intergenic
1111872203 13:93847009-93847031 TTATTCATACACAAGGAAAATGG + Intronic
1112720660 13:102240932-102240954 TCATTAGGAGAAAAGGCAAAGGG + Intronic
1112722152 13:102257730-102257752 CCACTAAGCCACAAGGAAAAGGG + Intronic
1112912034 13:104498173-104498195 TAATTAGAAAACAAGGAGAAGGG - Intergenic
1113243311 13:108364814-108364836 TCAGGGGGACACAAGGAAATTGG - Intergenic
1113551955 13:111199563-111199585 TCATTTGGACATGAGGAAGATGG - Intronic
1114956666 14:27829077-27829099 TCATTTCCACACAAAGAAAATGG - Intergenic
1115462503 14:33677017-33677039 TCAGTACAACACAATGAAAATGG - Intronic
1116199169 14:41770022-41770044 TCATTATGACAGAAGGCAAAGGG + Intronic
1116998487 14:51348579-51348601 TCATTATGACATAAGAATAATGG + Intergenic
1117083366 14:52174726-52174748 CCATGAAGACAGAAGGAAAATGG - Intergenic
1117401930 14:55366019-55366041 TCTTCAGGACAAGAGGAAAAGGG - Intergenic
1117676817 14:58163743-58163765 TTATAAGGACACAAGGCATATGG - Intronic
1118785677 14:69043819-69043841 TCATTAGGTCACAAGAAAGCAGG + Intergenic
1119955613 14:78795833-78795855 TCATAAGGACACACAGCAAATGG + Intronic
1120028816 14:79616430-79616452 GAATTAGGAAGCAAGGAAAAGGG + Intronic
1120652624 14:87152383-87152405 CCTTCAGAACACAAGGAAAAAGG + Intergenic
1120969601 14:90196351-90196373 TTATTGGGAGAAAAGGAAAAAGG - Intergenic
1122955569 14:105069074-105069096 ACATCAGGACAAAAGGACAAAGG - Intergenic
1123667454 15:22619019-22619041 TAATTAAGACATAAGGAAAAAGG + Intergenic
1123997081 15:25726394-25726416 ACATTTGGAAACTAGGAAAATGG - Intronic
1124481200 15:30081770-30081792 TAATTAAGACCTAAGGAAAAAGG - Intergenic
1124487653 15:30133865-30133887 TAATTAAGACATAAGGAAAAAGG - Intergenic
1124542742 15:30602842-30602864 TAATTAAGACATAAGGAAAAAGG - Intergenic
1124755876 15:32404456-32404478 TAATTAAGACATAAGGAAAAAGG + Intergenic
1124776246 15:32592284-32592306 TAATTAAGACCTAAGGAAAAAGG - Intergenic
1124967105 15:34441936-34441958 TCCTTAGGATCCAAGGGAAAGGG - Intergenic
1126066776 15:44831757-44831779 TCATTAGGAAGAAAAGAAAATGG + Intergenic
1126093054 15:45068798-45068820 TCATTAGGAAGAAAAGAAAATGG - Intronic
1127178798 15:56392437-56392459 TCATGAGGACACTACTAAAAGGG + Intronic
1127659030 15:61082672-61082694 TCATTGGGACTGAAGGAGAAAGG + Intronic
1127771701 15:62236662-62236684 GCAGAAGGACTCAAGGAAAAGGG - Intergenic
1129055379 15:72816144-72816166 TCATAAGGGCAGAAGAAAAAGGG - Intergenic
1129188778 15:73926040-73926062 GCTTTAGGGAACAAGGAAAAGGG + Intronic
1129934309 15:79436942-79436964 TCACTAGGACACAAAGTAAATGG - Intronic
1134103275 16:11467916-11467938 TTATAAGGACACCAGGCAAACGG - Intronic
1134753742 16:16648091-16648113 TGATTAGGACCAAAGGAAAAAGG + Intergenic
1134992317 16:18710952-18710974 TGATTAGGACCAAAGGAAAAAGG - Intergenic
1136602722 16:31306215-31306237 TCATTAGGACACAAGGAAAAAGG - Intronic
1139060585 16:63245793-63245815 TCATTAGAACACAGGAAAAGGGG - Intergenic
1139774510 16:69307865-69307887 GCATTTGGACTCAATGAAAAGGG + Exonic
1140535444 16:75705252-75705274 TGAGGAGGACACAAGTAAAAGGG + Intronic
1140589232 16:76331847-76331869 TCCTTTGGACAGAAAGAAAAGGG - Intronic
1143395519 17:6592345-6592367 TCATGAAGACAAAAGGAAATGGG - Intronic
1144243932 17:13344312-13344334 TAATTAGTAGTCAAGGAAAAAGG + Intergenic
1144303561 17:13946672-13946694 TCATTAGAAAACAAAGAAAAGGG - Intergenic
1144802006 17:17935736-17935758 CCATTAGGACATAAGGAACGAGG + Intronic
1145122587 17:20273870-20273892 GCATTAACAGACAAGGAAAAAGG - Intronic
1149511410 17:57244558-57244580 TGAGTTGGAGACAAGGAAAAAGG + Intergenic
1150509122 17:65730538-65730560 TCCGTAGGGCACAAGGAAAGTGG - Intronic
1150885327 17:69079076-69079098 TAATTAGGAGACAAAGAAGAAGG + Intronic
1155479602 18:26271519-26271541 TCTTGAGGACAGGAGGAAAACGG - Intronic
1155643552 18:28049606-28049628 TCATAAGGAAACAAAGCAAATGG + Intronic
1158265155 18:55653597-55653619 TGATTAGGATGCAAGGTAAAAGG + Intronic
1158811983 18:61048187-61048209 TCATAAGGACATAAAGCAAATGG - Intergenic
1159091185 18:63851328-63851350 TCAATAGGAGACAAGGTCAAAGG + Intergenic
1160700993 19:507345-507367 CAATAAGGACACAAGGAAAGTGG + Exonic
1162455339 19:10780592-10780614 TCATTAGTACGCCAGGAAAAAGG - Intronic
1163361002 19:16846545-16846567 TCACTGAGACCCAAGGAAAATGG - Intronic
1167549423 19:50149637-50149659 TTATCGGAACACAAGGAAAAAGG - Intergenic
1168402543 19:56093700-56093722 GCATTATGACTCACGGAAAAGGG - Intronic
925057880 2:869430-869452 TCATTTGTCCACAAGGAAACTGG - Intergenic
925143804 2:1567967-1567989 TCATTACAACAGAATGAAAAGGG + Intergenic
926548566 2:14272488-14272510 TCATTAGCAAAAGAGGAAAATGG + Intergenic
926624659 2:15081141-15081163 TGTTTGGGTCACAAGGAAAAAGG - Intergenic
926702793 2:15815023-15815045 ACATTTGCACAGAAGGAAAATGG - Intergenic
929745369 2:44652265-44652287 TTATAAGAACACAAGTAAAAGGG - Intronic
930356846 2:50331698-50331720 TCACTTGAACACAAGGAGAATGG - Intronic
931986922 2:67751178-67751200 TAATTAGGGCTCAAGGAACAAGG - Intergenic
932930735 2:76034794-76034816 TCTTCAGTACACAAGGAAAAAGG - Intergenic
932987409 2:76742928-76742950 TTATAAGGACACAGAGAAAAGGG + Intergenic
933884360 2:86704349-86704371 TGATTTGAACAAAAGGAAAAGGG - Intronic
933976252 2:87514498-87514520 TCAGTAGGAGAGAAGGAAATAGG - Intergenic
936317570 2:111436308-111436330 TCAGTAGGAGAGAAGGAAATAGG + Intergenic
936687684 2:114847393-114847415 CAATTAGGGCACAAGGAAGAAGG - Intronic
938005150 2:127783446-127783468 TCATCAGCACACAAAGCAAAAGG + Intronic
938162690 2:129000528-129000550 TTTTGAGGACTCAAGGAAAAAGG + Intergenic
939004691 2:136772345-136772367 TCATTTGGAAATATGGAAAAAGG + Intronic
939557293 2:143691319-143691341 TCATTAGGATGCCAGGATAATGG - Intronic
940721806 2:157290697-157290719 CCTTTAGGACTCAAAGAAAAGGG + Intronic
941351363 2:164441147-164441169 CCATTGGGACAAAAGGAACAAGG + Intergenic
941544715 2:166834460-166834482 TCAATAAGAAACAGGGAAAAGGG - Intergenic
941800619 2:169655883-169655905 TCAGTAGAACAAAAAGAAAACGG + Intronic
942203625 2:173596924-173596946 TCATTAGGTCATAAGTAAATAGG - Intergenic
942897606 2:181076366-181076388 TCAATAGAAAACAAGGAAATAGG + Intronic
943278741 2:185902302-185902324 TCCTTTGGAAATAAGGAAAATGG - Intergenic
943673607 2:190693887-190693909 ACATTAAGTCACAAGCAAAATGG - Intergenic
944288979 2:197983073-197983095 TCATTTGAACACAGGGATAAAGG - Intronic
945424549 2:209684127-209684149 TGATTAGGCCAAAAAGAAAAAGG - Intronic
945719145 2:213397014-213397036 TCATTAGCACAGAAGGTGAAGGG - Intronic
945957869 2:216103036-216103058 TGATTAGGACACAGGTAAAGTGG + Intergenic
947794810 2:232887539-232887561 TCATCAGGGCACAGGGAAAGTGG + Intronic
948711020 2:239825624-239825646 ACATTTGGACACAAGCAAATGGG + Intergenic
1170254481 20:14325251-14325273 TCAGTAGAACACAAAGTAAATGG + Exonic
1171542522 20:25975410-25975432 TCATAGGGACACAAAAAAAAGGG + Intergenic
1173110086 20:40178822-40178844 TTTTTTGGACTCAAGGAAAAAGG - Intergenic
1173126193 20:40338361-40338383 GCATAAGGACACATGCAAAATGG - Intergenic
1176930157 21:14800391-14800413 TAAATAGGACACAAGAAAAATGG - Intergenic
1177618331 21:23555160-23555182 TCATCAGGACAATGGGAAAATGG + Intergenic
1177729936 21:25015626-25015648 TAATTAAGAGACAATGAAAATGG - Intergenic
1178137121 21:29640205-29640227 TCATTAGGAAACATGAAATAAGG - Intronic
1182008166 22:26978810-26978832 TGGTTAGGATAAAAGGAAAAGGG - Intergenic
950466854 3:13160913-13160935 TCATTTGGACACAAAGCAGAAGG + Intergenic
951702194 3:25507748-25507770 TCAGGAGGTCAGAAGGAAAATGG + Intronic
953478031 3:43222508-43222530 TCATTGGGGCATAAGGAAAGTGG + Intergenic
954049392 3:47961009-47961031 TGATAAGGAAACAAAGAAAATGG - Intronic
954316989 3:49806573-49806595 TCATTGGGACACAGGGGCAAAGG + Intronic
956488332 3:69744759-69744781 TCATTAGAAGAAAAGCAAAAAGG - Intronic
956521914 3:70113923-70113945 TCATTAGGAAGCAAAGCAAATGG + Intergenic
956857155 3:73286543-73286565 TCAGTAGGAGAGAAGGAAAGAGG + Intergenic
958833493 3:99117140-99117162 TCGTTAGGAAACCAGGAAGAGGG + Intergenic
959667715 3:108940350-108940372 TGATTATGACACAAGTTAAAAGG + Intronic
960211494 3:114972580-114972602 TTATTAGTATACAAGAAAAAAGG + Intronic
960402685 3:117222566-117222588 GCATGAGGACACAGTGAAAAAGG - Intergenic
962742134 3:138369646-138369668 TAATTAGGACACAATGGAACAGG - Intronic
963791825 3:149590816-149590838 CCATTAGGAAGGAAGGAAAAGGG + Intronic
964090250 3:152867580-152867602 GCTTTAGGATACAGGGAAAAAGG - Intergenic
965476486 3:169161945-169161967 TCATCAGGTCACAGGGAAAATGG - Intronic
966008575 3:175048388-175048410 TCATCACAACACAAGAAAAAGGG - Intronic
966779060 3:183567924-183567946 TCATTCTGCCACAAGGAAAATGG - Intergenic
967092332 3:186145693-186145715 TCATAAAGAAACAAGAAAAAGGG + Intronic
967555386 3:190850622-190850644 TTATTAGGCAAAAAGGAAAAAGG - Intergenic
967870443 3:194224908-194224930 TCATTTTGAGACAAGGAAACTGG + Intergenic
970328106 4:14949495-14949517 TCATTAGGAGTTAAGGAAATAGG - Intergenic
971684652 4:29748311-29748333 ACATCACGACACAAGGTAAAAGG + Intergenic
972659500 4:41101607-41101629 TCATTAGGAAAAAATGAACACGG - Intronic
974604071 4:64126318-64126340 ATATTAGGACACAGTGAAAAAGG + Intergenic
975760159 4:77612339-77612361 TCAATATGACACAGTGAAAATGG - Intergenic
976311756 4:83620242-83620264 CTAATAGGACACAATGAAAAGGG - Intergenic
978742471 4:112152733-112152755 GCATTATGAAACAATGAAAAGGG + Intronic
979503730 4:121469148-121469170 ACCTTAGGACACATGGAAAAGGG - Intergenic
979753208 4:124304980-124305002 ACATTGGCAGACAAGGAAAATGG + Intergenic
981189981 4:141851331-141851353 TTATTTGGAGAAAAGGAAAAAGG - Intergenic
981965743 4:150600811-150600833 TCCTTAGGTGAGAAGGAAAAAGG + Intronic
983026451 4:162743494-162743516 TCAGAAGGAGAAAAGGAAAAGGG - Intergenic
984390601 4:179126698-179126720 ACATTTTGAGACAAGGAAAATGG + Intergenic
985478527 5:92643-92665 TCACGAGGTTACAAGGAAAAGGG - Intergenic
986111808 5:4726523-4726545 TGATTCGGAAATAAGGAAAACGG + Intergenic
986837268 5:11652293-11652315 TAATTATGACAGAAGGCAAAAGG - Intronic
987015291 5:13811857-13811879 TTATTAGCACACTAGGAAAATGG + Intronic
987117431 5:14736827-14736849 CCATTAGCACACAATGGAAATGG - Intronic
987385935 5:17329392-17329414 GCATTAGGAAAGAAGAAAAAAGG - Intergenic
987436389 5:17899166-17899188 TCATTAGTACAGATGGAAATAGG - Intergenic
987587898 5:19881174-19881196 ACATTTGGAAACAAGGAAAAGGG + Intronic
987652395 5:20759660-20759682 TCATGAGGAAAAGAGGAAAATGG + Intergenic
987730010 5:21757591-21757613 TCATTATAAAACAAGGAACATGG + Intronic
987918430 5:24247830-24247852 TCATTAAAACACATGGAAATAGG + Intergenic
987963300 5:24838386-24838408 TGAATAGAACACAAGGAAGAAGG - Intergenic
988148546 5:27345230-27345252 TAATTGGGACAGAAGGAAAATGG - Intergenic
988384941 5:30550872-30550894 TCTTTAAGAAAAAAGGAAAACGG - Intergenic
988743164 5:34101823-34101845 TCATGAGGAAAAGAGGAAAATGG - Intronic
988788526 5:34585982-34586004 TCATTTTGACTCAAGGAACATGG - Intergenic
990564281 5:57013530-57013552 ACATGAGGACACAGTGAAAAAGG + Intergenic
991197598 5:63954580-63954602 TGATTAGGTCAGAAGGAAAGAGG + Intergenic
992865749 5:80955648-80955670 TCATAAGGACACCAGATAAATGG + Intergenic
993301860 5:86221137-86221159 TCAATAGGACCCAGGTAAAATGG + Intergenic
993679027 5:90852107-90852129 TCAATAGGAGACATGGACAAAGG + Intronic
994409935 5:99394487-99394509 TGATAAAGACACAATGAAAAAGG + Intergenic
994483886 5:100370794-100370816 TGATAAAGACACAATGAAAAAGG - Intergenic
995226390 5:109705900-109705922 TCATAAGGAAAAGAGGAAAATGG - Intronic
995897223 5:117028602-117028624 TCACAAGGAGACAAGGGAAATGG + Intergenic
995993452 5:118270588-118270610 TCATTTGGACACAAGTCAAAGGG - Intergenic
996042488 5:118831377-118831399 TCAATAGGTCACATGGAAAAAGG + Intergenic
998662561 5:144256216-144256238 TCATTTGGACAAAACAAAAAAGG + Intronic
998951732 5:147399237-147399259 TCAATAGGCCACAGGGAAAATGG - Exonic
999106339 5:149074608-149074630 ACATTATTACACAAGGAAGAAGG + Intergenic
1001095218 5:168770849-168770871 TAAGTAGGAGAAAAGGAAAATGG - Intronic
1002295661 5:178229745-178229767 TCAATAAGAGACAAGGAAACTGG + Intronic
1002867922 6:1139900-1139922 TCCTTCAGACAGAAGGAAAATGG + Intergenic
1002872663 6:1181125-1181147 TCATTAGAATTCTAGGAAAAGGG + Intergenic
1002906420 6:1452825-1452847 TCATGAGAACACAAGGGAGAAGG - Intergenic
1003204575 6:3995292-3995314 TCATGTTCACACAAGGAAAATGG - Intergenic
1003466032 6:6380898-6380920 ATGTGAGGACACAAGGAAAAAGG + Intergenic
1003784549 6:9470125-9470147 ACAAGAGGACACAGGGAAAATGG - Intergenic
1003790697 6:9544142-9544164 TCATGAAGACAGAAGAAAAATGG + Intergenic
1005013161 6:21355207-21355229 TCATAATCACACAAGGAAGAAGG + Intergenic
1005327712 6:24719551-24719573 TCATGACGGCAGAAGGAAAAGGG + Exonic
1005692487 6:28320760-28320782 TGATTAGGTTACAAAGAAAACGG + Intergenic
1006952672 6:37837261-37837283 TCAATATGACACAAGAAGAAAGG + Intronic
1007194604 6:40049728-40049750 TCATTAGAATACAGGGAAAGAGG + Intergenic
1007443497 6:41885343-41885365 TCATTAGGAGACATCTAAAAAGG - Intronic
1009058768 6:58372158-58372180 TGATTAGGGCAAAAGGCAAAAGG + Intergenic
1009321441 6:62294866-62294888 TGATTAGGAGAAAAAGAAAATGG + Intergenic
1009622190 6:66091967-66091989 TTATCAGGAAACAAGAAAAACGG + Intergenic
1011144432 6:84196949-84196971 TCAAGAGGACATGAGGAAAAAGG + Intronic
1011305906 6:85926541-85926563 TCATAATCACACAAGGTAAATGG + Intergenic
1011404041 6:86998651-86998673 ACATTAAGAGACCAGGAAAAGGG + Intronic
1011852465 6:91647210-91647232 ACAAAAGGACAAAAGGAAAATGG - Intergenic
1011906659 6:92378382-92378404 TCATTAACACACAAAGACAAAGG - Intergenic
1012124784 6:95415038-95415060 ACATAAGGACACAATGACAAAGG + Intergenic
1013875993 6:114829430-114829452 TCATCAGGAACTAAGGAAAATGG - Intergenic
1013884221 6:114942399-114942421 TCATTAGCTCACAAGGAGAAAGG - Intergenic
1014093176 6:117428669-117428691 TGATTAGGACACACAAAAAATGG - Intronic
1015905647 6:138113981-138114003 TCAATAGGATACATGGGAAATGG + Intergenic
1016348605 6:143142829-143142851 TCCTTAGGAAACATGGAAAATGG + Intronic
1017813176 6:157998906-157998928 TCATTCGGACACAGGGGGAATGG - Intronic
1018153788 6:160965846-160965868 TCATAAGGACACAAGAGGAATGG - Intergenic
1018796799 6:167192067-167192089 ATATTAGGACAAAAAGAAAAAGG - Intronic
1018819522 6:167363044-167363066 ATATTAGGACAAAAAGAAAAAGG + Intronic
1020579772 7:9981731-9981753 TCATTAGGTTACAGGGAGAATGG + Intergenic
1021085248 7:16415187-16415209 TGATTTTGACAAAAGGAAAATGG + Intronic
1021670436 7:23030241-23030263 TCATGAAGACACAAGATAAATGG - Intergenic
1022477457 7:30720875-30720897 ACATTAGGTCACATGGCAAAGGG + Intronic
1022618864 7:31961835-31961857 TGATAAGGACATAAAGAAAATGG - Intronic
1022895881 7:34750015-34750037 TCATTAGAAAACAAGGAGACTGG + Intronic
1023092211 7:36627918-36627940 GCATTATGACAAAAGAAAAATGG + Intronic
1023107078 7:36773131-36773153 TCATTAGGAACCAAGGGCAAGGG + Intergenic
1023210505 7:37798941-37798963 CCAATAGAACACAAGGAAAGTGG + Intronic
1023407243 7:39847825-39847847 TGACTAGGACACAGGAAAAAAGG - Intergenic
1025107371 7:56183101-56183123 TCATTCTGATACAAAGAAAAGGG + Intergenic
1026570507 7:71525617-71525639 TGATTATGACAGAAGGCAAAAGG - Intronic
1029053844 7:97719048-97719070 TCATGAGGATGCAGGGAAAAGGG + Intergenic
1029963387 7:104712013-104712035 ACATTAGGATACATGGAAAGGGG + Intronic
1029971165 7:104790801-104790823 TCATTTGTATGCAAGGAAAATGG - Intronic
1035264081 7:157680221-157680243 TCACTGGGTTACAAGGAAAATGG - Intronic
1037988231 8:23302921-23302943 GCATTGGGACACCAGAAAAAAGG + Intronic
1038146299 8:24899526-24899548 TCATTAGGTTCCAAGGAGAAAGG + Intergenic
1038491309 8:27973853-27973875 TCAATAGGACACATCGAAAATGG + Intronic
1038564759 8:28610472-28610494 TCATTTGGACCAGAGGAAAAAGG + Intronic
1038845390 8:31224314-31224336 TCATTAGAACACAAAGTAGATGG + Intergenic
1039263099 8:35794356-35794378 TCATGAGGAAACAATGACAATGG - Intronic
1040726089 8:50383596-50383618 TGCTGAGGACACAAGGAATAAGG - Intronic
1041596028 8:59654159-59654181 TCCTTAGCACACATGGAACATGG + Intergenic
1041962404 8:63633651-63633673 TGATTAGGACAGAAGGATAGAGG - Intergenic
1042604777 8:70534511-70534533 TCCTTAAGACACAGGCAAAATGG - Intergenic
1042648585 8:71014146-71014168 TCATTAAGCCCCAAGGTAAAAGG - Intergenic
1043001539 8:74766051-74766073 GCATTAGTTCACAAGGATAATGG - Intronic
1044094529 8:88046668-88046690 GCATTTGTACACAAAGAAAATGG - Exonic
1044355365 8:91216316-91216338 TCCTAATGACACAAGGGAAATGG + Intronic
1044647978 8:94464845-94464867 TAATTAGGGCAGAAGGTAAAGGG + Intronic
1044912495 8:97075251-97075273 TCATTAGAAGGCACGGAAAATGG - Intronic
1045067912 8:98468418-98468440 TTGTAAGGACACAAGAAAAAAGG + Intronic
1045189430 8:99868354-99868376 TCAGCAGGACACAAGGCCAAGGG + Exonic
1045427299 8:102079885-102079907 AAATTAAGACACAAGGATAATGG + Intronic
1046053708 8:109054738-109054760 TGATAAGAACACAAGGAGAAAGG + Intergenic
1046194509 8:110842243-110842265 TCAATGGAATACAAGGAAAATGG - Intergenic
1046210141 8:111061574-111061596 TGATTAGGAGACTTGGAAAAGGG - Intergenic
1046318494 8:112538688-112538710 ACAATAGGACACAAGAAAAATGG + Intronic
1047372961 8:124271347-124271369 TCATAAGGACACCAGTGAAATGG - Intergenic
1049930548 9:452111-452133 TCATGAGGTAAGAAGGAAAATGG + Exonic
1050273715 9:3974298-3974320 TAATTAGAAAAGAAGGAAAAGGG - Intronic
1050960535 9:11724383-11724405 TCAATGGGAGAAAAGGAAAAGGG + Intergenic
1051877155 9:21804918-21804940 GCATTAGGTCACAAGAAAACAGG - Intronic
1051961528 9:22770150-22770172 TCTTTAGAACACAAGAAAAAAGG - Intergenic
1052322931 9:27187820-27187842 AAATTAGGACACAAGTACAAAGG - Intronic
1055244081 9:74219112-74219134 TTAATAGGACAGAAGGAAGATGG - Intergenic
1055268744 9:74531007-74531029 GCCTTATGAAACAAGGAAAAAGG - Intronic
1057028522 9:91755736-91755758 TCATTAGGACATTGGGAAACAGG - Intronic
1057311164 9:93944136-93944158 TCATCAGCCCACAAGGAGAAAGG + Intergenic
1058941764 9:109819952-109819974 TCAATAGGAAAACAGGAAAATGG + Intronic
1059030179 9:110684625-110684647 TCATGAGGACACCAAAAAAATGG - Intronic
1059046692 9:110876842-110876864 TCATTTGGATCCCAGGAAAATGG + Intronic
1059260856 9:112975260-112975282 TCATAAGGAGAAAGGGAAAATGG + Intergenic
1059547307 9:115190691-115190713 TGAAGAGGACACAAAGAAAATGG + Intronic
1059634558 9:116158147-116158169 CCATTAGAACAAAAGAAAAAAGG - Intronic
1062129480 9:134884895-134884917 TAATTAGGGGACAAGGAAACGGG - Intronic
1062515592 9:136933618-136933640 TCATCAGGACAGTGGGAAAATGG + Intronic
1185928089 X:4169903-4169925 CCATTAGGACCAATGGAAAATGG - Intergenic
1186376018 X:9002437-9002459 TCATTTTAACACAAGAAAAATGG + Intergenic
1189617733 X:42801073-42801095 TCTTTAGGACACAAGAAGGAAGG - Intergenic
1189843018 X:45102259-45102281 TCACTAGGCCACCATGAAAAAGG - Intronic
1190586372 X:51947527-51947549 TAATTAAGACAAAAGGGAAATGG - Intergenic
1191781830 X:64877389-64877411 TCATTAGAACACATGGACACAGG + Intergenic
1192754002 X:74025995-74026017 TGAATAGGACACAATGAAATGGG + Intergenic
1194206105 X:91013726-91013748 ACATTAGGACTCAAAGTAAAAGG - Intergenic
1194850976 X:98868656-98868678 TTATTAGAACATAAGGAAATAGG - Intergenic
1195650539 X:107278713-107278735 TCATTATGATACAATGATAAAGG - Intergenic
1196167608 X:112552578-112552600 TGATTAGGACACAGGGAAACAGG - Intergenic
1196253356 X:113487256-113487278 TTATTAGCAGAAAAGGAAAAAGG - Intergenic
1196314852 X:114210652-114210674 TAGTTAGGACTCAAAGAAAAGGG - Intergenic
1196352640 X:114750040-114750062 CCAATCGGCCACAAGGAAAATGG - Intronic
1197999976 X:132423658-132423680 TCATTAGGAAAAAAGGAGAAAGG - Intronic
1198475513 X:136993446-136993468 TCATTAGGAAACAAGGGGTAGGG - Intergenic
1199460317 X:148076704-148076726 TCATAAGGGCACAAAGAGAAAGG + Intergenic
1201782795 Y:17741941-17741963 TCATGGGGCCAGAAGGAAAAAGG - Intergenic
1201818758 Y:18164046-18164068 TCATGGGGCCAGAAGGAAAAAGG + Intergenic