ID: 1136606433

View in Genome Browser
Species Human (GRCh38)
Location 16:31337385-31337407
Sequence ATCACGGAAGGTCCTACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136606433_1136606440 3 Left 1136606433 16:31337385-31337407 CCATGTGTAGGACCTTCCGTGAT No data
Right 1136606440 16:31337411-31337433 CCCATGTGGCTTGGTCTCTAGGG No data
1136606433_1136606438 2 Left 1136606433 16:31337385-31337407 CCATGTGTAGGACCTTCCGTGAT No data
Right 1136606438 16:31337410-31337432 GCCCATGTGGCTTGGTCTCTAGG No data
1136606433_1136606437 -6 Left 1136606433 16:31337385-31337407 CCATGTGTAGGACCTTCCGTGAT No data
Right 1136606437 16:31337402-31337424 CGTGATGAGCCCATGTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136606433 Original CRISPR ATCACGGAAGGTCCTACACA TGG (reversed) Intergenic
No off target data available for this crispr