ID: 1136607465

View in Genome Browser
Species Human (GRCh38)
Location 16:31346087-31346109
Sequence CTGAATATACAAAGGGATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136607460_1136607465 17 Left 1136607460 16:31346047-31346069 CCGCACCTGGCATACTTCACATT No data
Right 1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG No data
1136607459_1136607465 20 Left 1136607459 16:31346044-31346066 CCACCGCACCTGGCATACTTCAC No data
Right 1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG No data
1136607461_1136607465 12 Left 1136607461 16:31346052-31346074 CCTGGCATACTTCACATTTTCTA No data
Right 1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136607465 Original CRISPR CTGAATATACAAAGGGATAG TGG Intergenic
No off target data available for this crispr