ID: 1136615064

View in Genome Browser
Species Human (GRCh38)
Location 16:31393546-31393568
Sequence GAGTGTGACCTGAATGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136615061_1136615064 -10 Left 1136615061 16:31393533-31393555 CCCGGAGTCAGTAGAGTGTGACC 0: 1
1: 0
2: 1
3: 9
4: 183
Right 1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136615064 Original CRISPR GAGTGTGACCTGAATGAAGA GGG Intronic
900805575 1:4765473-4765495 GAGAGAGACATGAGTGAAGAAGG + Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901367206 1:8762912-8762934 GAGTGTGACTTTACTGTAGAAGG - Intronic
902315973 1:15618500-15618522 AACTGTGACCTGAAAGAAAAAGG - Intronic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
903249029 1:22038921-22038943 GATTGTGAGCTCCATGAAGAGGG + Intergenic
905410846 1:37766848-37766870 GAGCGTGAGGAGAATGAAGATGG - Intergenic
905949261 1:41934014-41934036 TAGTGTGACATGTATGTAGAAGG - Intronic
908053108 1:60254480-60254502 GAGTGTCACATGGAGGAAGAAGG + Intergenic
909073843 1:71029198-71029220 GATTGTGAAATGAATGAAGAAGG - Intronic
909212924 1:72847042-72847064 TACTGTGACTTGAATGAAGCTGG + Intergenic
909412768 1:75374091-75374113 GCAAGTGACCTGAATGCAGAAGG + Intronic
909963426 1:81877561-81877583 TAGTTTGACCTGAATGAACCAGG + Intronic
910227857 1:84954822-84954844 GAATGTGAGCTCCATGAAGATGG - Intronic
910852379 1:91661485-91661507 GAATGTGAGCTCCATGAAGAGGG - Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912667993 1:111600241-111600263 CAATGTGAGCTGAAAGAAGAGGG - Intronic
914310201 1:146459435-146459457 GAGTGGGAGCTGAAAGGAGAAGG - Intergenic
915873103 1:159582985-159583007 GATTGTGAACAGCATGAAGATGG + Intergenic
916277800 1:163013957-163013979 CTGAGAGACCTGAATGAAGATGG - Intergenic
916326558 1:163566866-163566888 GATTATGACCTTAATGAAAAAGG - Intergenic
916835916 1:168544529-168544551 GGGGGTGACTTGAATGAAGGTGG - Intergenic
916838552 1:168576045-168576067 GGGGGTGACTTGAATGAAGGTGG + Intergenic
917720452 1:177782031-177782053 GAATGAGACCTGAGTGAAGGGGG + Intergenic
919355205 1:196513630-196513652 AAGTGAGAGCTGAAGGAAGAAGG - Intronic
922244046 1:223777502-223777524 GATTGTCACATGAATGGAGACGG - Intergenic
922844052 1:228668963-228668985 GATGGTGGCCTGAATGAAAAGGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923275780 1:232394700-232394722 GAGTTTGACCTGAAAGTAGTGGG + Intergenic
924225964 1:241921861-241921883 CAGTATGACCTGTAAGAAGAGGG + Intergenic
1065046828 10:21753105-21753127 GAGTGAGACCTGACTGGAGCTGG - Intergenic
1065788076 10:29234804-29234826 GAGTGAGACCTGAATGAACAGGG - Intergenic
1066277361 10:33881965-33881987 GAGTTGGACCTGAAGGGAGATGG + Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1066696551 10:38084240-38084262 GTGAGTGACCTGAGTGAACAAGG + Intergenic
1067760288 10:49039765-49039787 GACTGTTACCTGAATGGGGAAGG - Intronic
1068749086 10:60570732-60570754 GAGTGTGGAATGAAGGAAGAAGG + Intronic
1071647338 10:87367069-87367091 GAGGGTGGCCTGAATGGGGAGGG + Exonic
1072900763 10:99404564-99404586 GATGGTGACCTGGATGAAGTAGG - Intronic
1074268970 10:111934065-111934087 GAGGGTGACGAGAATGCAGATGG - Intergenic
1076334749 10:129698189-129698211 GAGAGAGACCAGAATGCAGAGGG + Intronic
1077444352 11:2583421-2583443 GACTGTGACCTGCAGGGAGAGGG - Exonic
1077464607 11:2727711-2727733 CAGAGTGAGCTGAATGGAGAAGG + Intronic
1077982503 11:7314867-7314889 GTGTCTGAGCTGAATAAAGACGG - Intronic
1077999008 11:7478186-7478208 GAGAGGGCACTGAATGAAGAAGG - Intergenic
1079125522 11:17716014-17716036 AACTGTGACATTAATGAAGATGG - Intergenic
1083119992 11:60502313-60502335 GAGTGTGACCAGACTGAACCAGG - Intronic
1083985252 11:66210438-66210460 GAGTCTCACCTGAAGGGAGAAGG - Exonic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1088343230 11:108793173-108793195 GAGTGTCACCTGAGAGAAAAAGG - Intronic
1089638308 11:119830943-119830965 GAGGGTGACATGGAGGAAGAAGG - Intergenic
1095539762 12:43295732-43295754 GACTGTGAGCTCCATGAAGATGG + Intergenic
1097444121 12:59647365-59647387 GAATGAGAGCTGAACGAAGAGGG - Intronic
1100370646 12:93966135-93966157 GGGTGTGATCAGAATGACGAAGG - Intergenic
1101320462 12:103668930-103668952 GAGTGTGATCTGTGTTAAGAGGG - Intronic
1101329581 12:103746662-103746684 GAGTGTAACCTGGATTATGAAGG + Exonic
1102231666 12:111266802-111266824 GCGTGTGGCCTGGATGAAGAGGG + Intronic
1106537741 13:30662706-30662728 CAGTGTGAACTGAAAGAGGAAGG + Intergenic
1106762982 13:32885233-32885255 CAGAATGACCTGAATGAAAATGG + Intergenic
1107124276 13:36829342-36829364 CAGTGAGAGCTGAATGAAAAGGG + Intergenic
1107730775 13:43346218-43346240 GTGTGTGTCCTGAATGAAGGTGG + Intronic
1111236093 13:85410254-85410276 GACTGTGACCATAATGAAGTAGG + Intergenic
1111265860 13:85812326-85812348 GACTCTGACCTGAATAATGAGGG - Intergenic
1112032570 13:95471121-95471143 CACTGTGACCTGAAGGAAAAGGG + Intronic
1113661678 13:112111468-112111490 CAGTGTGACCTGAATCTTGATGG - Intergenic
1115461927 14:33670845-33670867 GAGTGGGGCCTGGATGCAGAAGG + Intronic
1117766075 14:59084836-59084858 GAGAGTGACATGAGTGTAGAAGG - Intergenic
1117950639 14:61079822-61079844 GAGTGTGCCCTGAACAACGAAGG + Intronic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118404148 14:65406990-65407012 GAGTGAGGACTGAATTAAGAAGG - Intergenic
1118454843 14:65935156-65935178 GAGTGAGACCTGAAGGAAATAGG + Intergenic
1119165113 14:72486103-72486125 GAATGAGAACTGAATGAAGGGGG - Intronic
1119806538 14:77485765-77485787 GGGTGTGGCCTGAGTGAAGCAGG - Intronic
1120622447 14:86780916-86780938 AAGTGGGACTTGGATGAAGAAGG - Intergenic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1122373262 14:101241202-101241224 GAGTGGGACCTGCAGGAAGCGGG - Intergenic
1122682313 14:103475052-103475074 GATAGTGACCTCAAAGAAGATGG + Exonic
1124210686 15:27762645-27762667 GAGGGTGACATGCATGAAGTAGG - Intronic
1124863085 15:33461881-33461903 GAATGTGACCTCCATGAAGGTGG + Intronic
1125693689 15:41617520-41617542 GAGTGTGACCTGATAGATTAGGG - Intergenic
1126750021 15:51867096-51867118 CAGTGTGACTGGAATGGAGAGGG + Intronic
1127095260 15:55506486-55506508 GAGTGTTACTAGAATTAAGAGGG - Intronic
1128274412 15:66340684-66340706 GAGAATCACCTGAATCAAGAAGG - Intronic
1128646260 15:69380900-69380922 GAGTGTGCCATGAGTGGAGATGG + Intronic
1128898574 15:71398356-71398378 GAGGGTGACCTGAAGAAGGAAGG + Intronic
1131298194 15:91170945-91170967 GAGTGAGTCCACAATGAAGAGGG - Intronic
1131456235 15:92584710-92584732 GAGTGGGATCTGAAAGACGATGG - Intergenic
1132106331 15:99065449-99065471 GAGTGTGATGTGAATCTAGAAGG + Intergenic
1134448952 16:14351828-14351850 GTGCGTGACATGAATGAAGCTGG - Intergenic
1136517612 16:30777413-30777435 GAAAGTGACCTGAAGGATGAGGG - Intergenic
1136615064 16:31393546-31393568 GAGTGTGACCTGAATGAAGAGGG + Intronic
1137003681 16:35252946-35252968 GAGTGTGGCCTGGATGTGGAAGG + Intergenic
1137017525 16:35392741-35392763 GAGTGTGGCCTGAATGTGGAAGG - Intergenic
1137496863 16:48976363-48976385 GATTATGACCTGAAGTAAGATGG + Intergenic
1138567852 16:57846438-57846460 GAGGGTGACCTAACAGAAGAGGG + Intronic
1139921182 16:70461516-70461538 GAGAGTGCCCTGGAGGAAGATGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1140108130 16:71979749-71979771 GATTGTGATCAGAATGAAAATGG - Intronic
1142411644 16:89920025-89920047 GAGTGTGAGATGCAGGAAGAAGG - Exonic
1142728050 17:1830623-1830645 GGGTGTGACCTGAAGCAAGCAGG - Intronic
1142941464 17:3383040-3383062 GAGAGTGACCAGAATGGAAAAGG + Intergenic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1146307716 17:31743421-31743443 GAGGTTGACCTTAATGAAGAAGG + Intergenic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1148603201 17:48909077-48909099 GAGGGTGGCCGGAATGGAGACGG - Intronic
1153217238 18:2832098-2832120 CAGTGTGAGCTGAAACAAGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155884241 18:31187872-31187894 GATTGTGCCCTGAATAAGGAAGG + Intergenic
1156897216 18:42259420-42259442 GAGTGTGAGCAGGATGAAGTTGG - Intergenic
1158124207 18:54083670-54083692 GAATGAGAGCTGAATGAAGGGGG - Intergenic
1158897224 18:61926067-61926089 GAGTGTAACTTGAAAGAAAATGG - Intergenic
1161430462 19:4229406-4229428 GAGTCAGACCTGAAGGAAGTCGG + Intergenic
1163488249 19:17602212-17602234 GAGGGTGTCCTGAAGAAAGAAGG - Exonic
1163599640 19:18241131-18241153 GGGTGTGTCGGGAATGAAGAGGG + Intronic
1164310256 19:24039749-24039771 TAATGTGATCAGAATGAAGAAGG + Intronic
1164682314 19:30144147-30144169 GAGTGTGACCTGGCTGGAGGAGG - Intergenic
1166062131 19:40332857-40332879 GAGCGGGACCTGAAATAAGAGGG - Intronic
1166581183 19:43901536-43901558 GTGTGTGAGATGAATGAACAGGG - Intergenic
1166964673 19:46521752-46521774 GAGACTGATCTGAATGTAGATGG + Intronic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
926246269 2:11124054-11124076 GAGTGTGGCCTGACTGACGCAGG + Intergenic
926665363 2:15516111-15516133 GAGAGTTACATGAATGAAGACGG + Intronic
926982059 2:18583647-18583669 GAGTGTGACTTTAATAGAGAAGG - Intronic
927294256 2:21435535-21435557 AAGTGTGAGCTGAACGAAGGGGG - Intergenic
927696414 2:25242479-25242501 GGGTGTGACATGATTTAAGAAGG + Intronic
928017882 2:27675629-27675651 GCGTCTGAACAGAATGAAGAAGG + Exonic
929370383 2:41216570-41216592 GAGTGGGGCAGGAATGAAGAGGG - Intergenic
929671708 2:43881019-43881041 GCGTTAGGCCTGAATGAAGAAGG + Intergenic
929878678 2:45818030-45818052 GAGTATGACCTGAGACAAGAGGG + Intronic
931984697 2:67730416-67730438 GACTCTAAGCTGAATGAAGAGGG - Intergenic
933582234 2:84140622-84140644 GTGTGTGACATGAATGGAAATGG + Intergenic
933586938 2:84189272-84189294 AAATGTGACGTGAATGATGAAGG - Intergenic
933726237 2:85429305-85429327 GAGAGTGTCCTGGATGAAGTTGG + Intronic
936441862 2:112561082-112561104 GAGAGTGGCCTGTAAGAAGAGGG + Intronic
937366494 2:121265817-121265839 GAGTCTGCTCTGAATGAGGAAGG - Intronic
938927951 2:136061472-136061494 GAGTGTGAGTTGAATGGAAATGG - Intergenic
940399577 2:153232456-153232478 GAGTGTGTTCTAAAAGAAGAAGG - Intergenic
941193704 2:162419763-162419785 GAGCCTGGCTTGAATGAAGAAGG - Intronic
941493912 2:166177328-166177350 GTGTGTGCCCAGAATGAAAAAGG - Intergenic
942670894 2:178375730-178375752 GACTGTAACCTGACTAAAGAAGG - Intronic
943334720 2:186599910-186599932 GAGTGTGATCTGCAGTAAGAGGG - Intronic
944507654 2:200429414-200429436 GATTCTGACCTGATCGAAGAAGG + Intronic
944591847 2:201225211-201225233 GACTCTAAGCTGAATGAAGAGGG - Intronic
944875756 2:203962887-203962909 GAGTGTGACTAGACAGAAGATGG + Intergenic
946351094 2:219153508-219153530 AAGTCTGTCCTAAATGAAGATGG + Intronic
946788679 2:223275955-223275977 TAGTGGGACATGAATGAAGATGG + Intergenic
948515616 2:238501568-238501590 GAGTCTGTCCTCCATGAAGAGGG - Intergenic
1168797185 20:619276-619298 GTGTGAGAGCTGAAAGAAGAAGG + Intergenic
1169031214 20:2408639-2408661 GAGTCTGAGCTGTATCAAGAAGG + Intronic
1174080834 20:47969629-47969651 GGGTGTGGCCAGAATGAAGGCGG + Intergenic
1174616990 20:51843322-51843344 GACTGTGTGCTAAATGAAGATGG - Intergenic
1178413848 21:32387917-32387939 GAGAGTGACCTGAACACAGAAGG - Intronic
1183068951 22:35382984-35383006 GAACGTGGCCTGAATGAGGATGG + Intronic
1184372894 22:44093927-44093949 GTGAGTGACCTGCAGGAAGAAGG + Exonic
1184524007 22:45010734-45010756 CACTCCGACCTGAATGAAGATGG - Intergenic
1184641522 22:45874766-45874788 TAGTATAACCTGAATGAAAATGG + Intergenic
1184886138 22:47345408-47345430 GAGGGTGTCCTGCATGAGGAGGG + Intergenic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185231602 22:49687061-49687083 GAGTCAGACCTGAATTCAGATGG - Intergenic
949756957 3:7423127-7423149 GAGTGTGCTCTGAATTAAAATGG - Intronic
950997351 3:17517118-17517140 GAGTGTGACCTAGATCAAGGTGG - Intronic
955538843 3:59952815-59952837 GAGTGTGACCCTAATGGATAAGG - Intronic
956154284 3:66278400-66278422 GAGTGGAACCAGAATGGAGAGGG - Intronic
956856481 3:73280173-73280195 GAGTGGGAGGGGAATGAAGATGG + Intergenic
958525932 3:95258979-95259001 GAGTGAGACCTGAATGATAGAGG - Intergenic
958550259 3:95603278-95603300 GATTGTTACCTAAAAGAAGAAGG - Intergenic
960145203 3:114193450-114193472 GCGTCTGACCTGAATAAATAAGG + Intronic
961093641 3:124136778-124136800 GAGTGTGACCTGGGAAAAGATGG + Intronic
964541297 3:157782543-157782565 GGTTGTGAACTGAACGAAGAAGG + Intergenic
964847990 3:161064453-161064475 GAATATGACCTTAATGAGGAAGG + Intronic
967666689 3:192181136-192181158 GATTGAGAGCTGAATGGAGATGG + Intronic
969229782 4:5821949-5821971 GACTGAGCCCTGAATGAAGGTGG - Intronic
969971921 4:11056667-11056689 AAATGTGACAAGAATGAAGAAGG + Intergenic
970307844 4:14751734-14751756 GAATGAGAGCTGAATGAAGGGGG + Intergenic
970600096 4:17635163-17635185 GGGTTTGACTTGAAGGAAGATGG + Intronic
970971551 4:21989957-21989979 GAGGGAGACATGAAGGAAGAGGG - Intergenic
974039598 4:56846209-56846231 GAGGGTGAGCTGAATCCAGAGGG + Intergenic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
975785370 4:77881869-77881891 GAGAGAGACCTGAAGGAAGTAGG - Intronic
977074482 4:92435480-92435502 GGGTATGACATAAATGAAGAAGG - Intronic
981105086 4:140871806-140871828 GTGTGTGAACTGAAAGAAAAAGG + Intronic
983184573 4:164687130-164687152 TAGAGTGATTTGAATGAAGAAGG - Intergenic
983571075 4:169208748-169208770 GAGCTGGACCTGAATGAAGGAGG - Intronic
984212507 4:176867766-176867788 GAGTGTGTCATAAATGAAGATGG - Intergenic
985859130 5:2456544-2456566 CAGAGTGACCTGATTGGAGAGGG - Intergenic
988022303 5:25636713-25636735 TATTGTGATCTGAATGTAGATGG - Intergenic
988282889 5:29173101-29173123 GAATGAGAACTGAGTGAAGAAGG + Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
994953953 5:106502699-106502721 GAATGTGACCTTCATGAATATGG + Intergenic
997285680 5:132676503-132676525 GAGTGAGGACTGAGTGAAGAGGG - Intronic
999596571 5:153211612-153211634 GAGTGTGAACTAAGTGAAAAAGG + Intergenic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1003601608 6:7522632-7522654 GAGTTTTTCCTGAATGAGGATGG + Intergenic
1004561060 6:16751276-16751298 AAGTGTCAGCTGAATGAAAAAGG - Intronic
1004661810 6:17717410-17717432 GAATGTGACCTGAAGGGAGAAGG + Intergenic
1005522824 6:26614830-26614852 GAGAGAGACGTGAAGGAAGAGGG - Intergenic
1006088871 6:31616115-31616137 GAGTTTGACCTTAATGGAAATGG + Exonic
1007446688 6:41911990-41912012 GTGTGTGCGCTTAATGAAGAAGG + Intronic
1008950735 6:57155925-57155947 GATTGTGCACTGCATGAAGAAGG + Intronic
1010096731 6:72055260-72055282 GAGTGTGCTCTGAATGTAGCAGG - Intronic
1010469942 6:76215615-76215637 GACTTTGACCTGAAGGAAAAGGG - Intergenic
1010666349 6:78634590-78634612 GATTGTGGTCTTAATGAAGATGG - Intergenic
1013866142 6:114698456-114698478 GAGAGTGGCCAGAATGCAGAAGG + Intergenic
1015218769 6:130780624-130780646 CAGTGTGACCTATAGGAAGATGG + Intergenic
1015704555 6:136073653-136073675 GAATGTGACCTATATGGAGATGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018236836 6:161734756-161734778 GAGTGGGACCTGAGTGAATAAGG + Intronic
1018322362 6:162625018-162625040 GAGCCTTACCTGAGTGAAGAAGG - Intronic
1018626550 6:165784651-165784673 GAATGTGACCTGCATGGAAAAGG - Intronic
1020969987 7:14924035-14924057 GAATATGACCTGAAGGCAGAAGG + Intronic
1023878714 7:44306825-44306847 GAGTGTGAGTAGAATGAGGAGGG + Intronic
1024757451 7:52552291-52552313 GAGTGAGAGCTGAGCGAAGAGGG - Intergenic
1026205086 7:68250269-68250291 GAGTGTAAGCTTCATGAAGAAGG - Intergenic
1026855823 7:73754038-73754060 GAGGCTGACCTGATTGAAGCAGG - Intergenic
1030173150 7:106625197-106625219 GGGTGAGACCTGAAGGGAGATGG - Intergenic
1032064375 7:128754650-128754672 GAGTTTGATATGAATCAAGACGG + Exonic
1032906566 7:136374276-136374298 GAGTAAGGCCTGAATGAAGGCGG + Intergenic
1035908052 8:3535511-3535533 GAGTGTGACCTGTAAGACCACGG + Intronic
1037357278 8:18034683-18034705 AAGAGTGACTTGAATAAAGATGG - Intergenic
1039016005 8:33149505-33149527 AAGTGTAACCAGATTGAAGATGG - Intergenic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1041153082 8:54956559-54956581 GAAGGTGATGTGAATGAAGATGG - Intergenic
1042818283 8:72902222-72902244 GAGTCTAGACTGAATGAAGAAGG + Intronic
1047446368 8:124923756-124923778 GGGTGTGGGGTGAATGAAGAAGG - Intergenic
1048223840 8:132566358-132566380 GCCTGTGACTTGAATGAATAAGG - Intergenic
1049703228 8:144024341-144024363 GAGAGGGTCCTGAAAGAAGAGGG - Intronic
1050530047 9:6580783-6580805 GAGTGGGTCCTGAATGGAGAAGG - Intronic
1055573426 9:77640013-77640035 GACTGTCACCTGAGTGCAGATGG - Intronic
1057026291 9:91736324-91736346 GAGGGTGACCTGAACTTAGAAGG + Intronic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1060904051 9:127288525-127288547 GATGGTGACTTGAATGAAGATGG + Intronic
1061520463 9:131114588-131114610 GAGTTTGACCTGAACAATGAAGG + Exonic
1062372450 9:136247111-136247133 GAAGGTGACCCGAATGGAGAAGG + Intergenic
1186430162 X:9498394-9498416 GAGCTTGCCCTGAATGAATAAGG + Intronic
1189311599 X:40022687-40022709 GAGTGTGACCTAAATGACTCAGG + Intergenic
1194365382 X:93007570-93007592 GAGTGAGAGCTGAGTGAAGGAGG + Intergenic
1196174630 X:112627356-112627378 GCGTGTGACCTGAGCCAAGATGG - Intergenic
1200294147 X:154901187-154901209 GATGGTGACCTGAGTTAAGATGG + Intronic