ID: 1136615848

View in Genome Browser
Species Human (GRCh38)
Location 16:31397931-31397953
Sequence GTTCCCTGTGGAGCACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 224}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136615845_1136615848 -9 Left 1136615845 16:31397917-31397939 CCTGGCAGGCCATGGTTCCCTGT 0: 1
1: 0
2: 1
3: 13
4: 216
Right 1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG 0: 1
1: 0
2: 1
3: 8
4: 224
1136615837_1136615848 14 Left 1136615837 16:31397894-31397916 CCCGACGCCACGCCAGGTAGGTC 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG 0: 1
1: 0
2: 1
3: 8
4: 224
1136615833_1136615848 24 Left 1136615833 16:31397884-31397906 CCAGACAGTCCCCGACGCCACGC 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG 0: 1
1: 0
2: 1
3: 8
4: 224
1136615836_1136615848 15 Left 1136615836 16:31397893-31397915 CCCCGACGCCACGCCAGGTAGGT 0: 1
1: 0
2: 0
3: 5
4: 56
Right 1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG 0: 1
1: 0
2: 1
3: 8
4: 224
1136615844_1136615848 -8 Left 1136615844 16:31397916-31397938 CCCTGGCAGGCCATGGTTCCCTG 0: 1
1: 0
2: 1
3: 16
4: 245
Right 1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG 0: 1
1: 0
2: 1
3: 8
4: 224
1136615838_1136615848 13 Left 1136615838 16:31397895-31397917 CCGACGCCACGCCAGGTAGGTCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG 0: 1
1: 0
2: 1
3: 8
4: 224
1136615840_1136615848 7 Left 1136615840 16:31397901-31397923 CCACGCCAGGTAGGTCCCTGGCA 0: 1
1: 0
2: 1
3: 9
4: 86
Right 1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG 0: 1
1: 0
2: 1
3: 8
4: 224
1136615842_1136615848 2 Left 1136615842 16:31397906-31397928 CCAGGTAGGTCCCTGGCAGGCCA 0: 1
1: 0
2: 3
3: 15
4: 177
Right 1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG 0: 1
1: 0
2: 1
3: 8
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136615848 Original CRISPR GTTCCCTGTGGAGCACATGC TGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900228779 1:1545390-1545412 GCTCCCTGTGCAGTGCATGCTGG + Intronic
900877918 1:5358951-5358973 GGTCCATGTGGTGCAGATGCTGG + Intergenic
901376263 1:8841750-8841772 GATACATGTGGAGAACATGCAGG - Intergenic
902917654 1:19648374-19648396 GTCCCGTGGGGAGCACATTCAGG + Intronic
906630694 1:47364954-47364976 GTTCACTGTGTTGCGCATGCTGG + Intronic
909287705 1:73841176-73841198 GTCCCCTGTGGACCATATGTAGG - Intergenic
909610122 1:77542499-77542521 CTTCCCTGTGAAGCAGATGGAGG + Intronic
912022465 1:105122358-105122380 GTTCCATGTGGCTCACATGGAGG - Intergenic
913649937 1:120903646-120903668 GTTACGTGTGCACCACATGCAGG - Intergenic
915553996 1:156651336-156651358 CTTCCCTGTGGAGCACCTACTGG - Intronic
917526018 1:175789188-175789210 GTACCCTGTGGAGCACTGGCTGG - Intergenic
917933515 1:179840853-179840875 GATACATGTGGAGAACATGCAGG - Exonic
918665323 1:187143502-187143524 GATACATGTGCAGCACATGCAGG - Intergenic
920054901 1:203184628-203184650 GGTTCCTGTGGAGCACAGGGAGG + Exonic
921362409 1:214342146-214342168 GTTCTTTGTGGAGCACTGGCTGG - Intergenic
921955060 1:220973684-220973706 GATACATGTGGAGAACATGCAGG - Intergenic
922955673 1:229597360-229597382 GATCCCTGGGGAGCACCAGCTGG - Intronic
923359960 1:233201071-233201093 GATCCATGTGCAGAACATGCAGG - Intronic
923365815 1:233259489-233259511 GTTACATGTGCAGAACATGCAGG + Intronic
923772367 1:236948704-236948726 AGTCCCTGTGGAGCAGGTGCTGG - Intergenic
1063109302 10:3020729-3020751 GTTCCCAGAGGAGCAGCTGCAGG - Intergenic
1072625777 10:97110708-97110730 GTTCCCTCTGGAGCTGAGGCTGG + Intronic
1072974556 10:100046440-100046462 GTTCTCTGTGTAGCCCAGGCTGG - Intronic
1075898986 10:126023117-126023139 GATCCCTGACGAGCTCATGCAGG + Intronic
1077216010 11:1395437-1395459 GCTCCCTGTGGAGGGCATGCAGG - Intronic
1077235930 11:1482006-1482028 CTTCCCTGTGGTGGACACGCTGG - Intronic
1077529136 11:3086959-3086981 CCGCCCTGTGGAGCAAATGCTGG - Intergenic
1078087720 11:8244125-8244147 GCTCCCTGTGAAGCCCCTGCAGG - Intronic
1078259891 11:9695707-9695729 GATACCTGTGCAGCACGTGCAGG - Intronic
1079296987 11:19242292-19242314 GTTCCCTGTAGAGCCCTAGCAGG + Intergenic
1081013343 11:37844018-37844040 GTTCCCTCTGTTGCCCATGCTGG + Intergenic
1082628208 11:55510031-55510053 GCTCTTTGTGGAGCACTTGCTGG + Intergenic
1082765457 11:57164033-57164055 GTCCTCAGTGGAGCACATGAGGG - Intergenic
1083928109 11:65821434-65821456 GTTCCCAGGGGAGAACTTGCAGG + Intergenic
1084448296 11:69217191-69217213 GTGCCCAGTGGGGCAAATGCGGG + Intergenic
1086132731 11:83418685-83418707 GTTACCTGTGAAGCACATAAAGG - Intergenic
1090217979 11:124987585-124987607 GGTCTTTGTGGAGAACATGCTGG - Exonic
1091274353 11:134340400-134340422 GTTCCCTCAGAGGCACATGCTGG - Intronic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1092099102 12:5868744-5868766 GTTCCATGTGGTGTGCATGCAGG - Intronic
1093429856 12:19072124-19072146 GTTACATGTGCAGAACATGCAGG - Intergenic
1094344430 12:29451124-29451146 GTTACATGTGCAGAACATGCAGG - Intronic
1094430876 12:30367982-30368004 GTTACATGTGGAGGATATGCAGG + Intergenic
1096515103 12:52151424-52151446 GTTCCTTGGGGAGTAGATGCTGG - Intergenic
1096744153 12:53714624-53714646 TTTCCTTCTGGAGCACACGCAGG + Exonic
1097410687 12:59248791-59248813 GATACATGTGGAGAACATGCAGG - Intergenic
1097698676 12:62798883-62798905 GTTCCCTGGGGAGGTGATGCTGG - Intronic
1098103968 12:67049687-67049709 GATACATGTGGAGAACATGCAGG - Intergenic
1099743825 12:86676287-86676309 GTGCCCTGTAGAGAACATGGTGG + Intronic
1101568591 12:105932854-105932876 GATACATGTGGAGAACATGCAGG + Intergenic
1102431677 12:112889006-112889028 CTTCCCTGTGGAGAGCAGGCAGG - Intronic
1102708282 12:114902176-114902198 GTTACATGTGCAGAACATGCAGG + Intergenic
1107668643 13:42719223-42719245 GGTGCCTGTGGGACACATGCAGG + Intergenic
1107900175 13:45004675-45004697 GCTCACTCTGGCGCACATGCTGG + Intronic
1108151267 13:47537168-47537190 GTTACATGTGCAGAACATGCAGG - Intergenic
1108458572 13:50642177-50642199 GTTCCATGATGAGCAAATGCAGG - Intronic
1109068941 13:57737945-57737967 GTTTCCTGTGGAGCACTGACAGG + Intergenic
1112347530 13:98602867-98602889 GGTCCATGTGCAGAACATGCAGG - Intergenic
1113028020 13:105962510-105962532 GTGCCATGTGGAGCATATGAGGG - Intergenic
1113636370 13:111921597-111921619 GTTCCCTGCAGAGAACACGCTGG + Intergenic
1114316698 14:21516169-21516191 ATTCCCTGAGAAGCAGATGCTGG + Intergenic
1114319406 14:21534742-21534764 GTCTCCTGTAGAGCACAAGCAGG + Intronic
1116553106 14:46267396-46267418 GATACCTGTGCAGAACATGCAGG - Intergenic
1118515527 14:66524530-66524552 GGTACCTGTGCAGAACATGCAGG + Intronic
1123623520 15:22211523-22211545 GGTACGTGTGGAGGACATGCAGG - Intergenic
1123707710 15:22962299-22962321 GCTCACTGTGGATCACAAGCAGG - Intronic
1124097077 15:26658704-26658726 GTTCCCTGTCCAGCATTTGCAGG + Intronic
1125535185 15:40438325-40438347 GTTCCCTTTGGGGGACAGGCAGG + Intergenic
1126340403 15:47635045-47635067 GCTCCCTGTGAAGAATATGCAGG + Intronic
1127098312 15:55535539-55535561 GTTCTCTGTGCACCACAGGCAGG - Intergenic
1127849186 15:62898032-62898054 GTTCCCAGTGGAAAACTTGCTGG + Intergenic
1127904860 15:63368923-63368945 GTTCCCTGTCTAGCCCATGGGGG - Intronic
1127972829 15:63975137-63975159 AGCCCCAGTGGAGCACATGCTGG - Intronic
1131032475 15:89197731-89197753 GGCCCCTGTGGAGGACAGGCAGG + Exonic
1134100665 16:11449415-11449437 GTACCCTGAAGGGCACATGCTGG + Intronic
1134836443 16:17365209-17365231 CTTCCCTGAGGAGGAAATGCTGG - Intronic
1135931537 16:26742049-26742071 GATACATGTGGAGAACATGCAGG - Intergenic
1136227732 16:28870317-28870339 GTCCCCTGAGCAGCACAAGCAGG + Intronic
1136615848 16:31397931-31397953 GTTCCCTGTGGAGCACATGCTGG + Intronic
1136655794 16:31708464-31708486 GCTCCTTGTGGGGCACAGGCAGG - Intergenic
1137052015 16:35722439-35722461 CATCTCTGTGGAGCACAGGCTGG - Intergenic
1137081002 16:36054101-36054123 GTTCCCTTTGAAGCATATGTTGG + Intergenic
1138001649 16:53287159-53287181 TCTCCCTGTGTTGCACATGCTGG + Intronic
1141196622 16:81865787-81865809 GTGCCCAGTGGAGCCCATCCTGG - Intronic
1141196693 16:81866072-81866094 GTGCCCAGTGGAGCCCATCCTGG - Intronic
1141196836 16:81866698-81866720 GTGCCCAGTGGAGCCCATCCTGG - Intronic
1148204999 17:45774626-45774648 GATCCCCGTGGAGGAAATGCAGG - Intergenic
1148818747 17:50348004-50348026 GATGCCTGTGAAGCACTTGCAGG + Intronic
1149695231 17:58611309-58611331 GTTCCCAGTGCTGCACATGGAGG - Exonic
1152442838 17:80319531-80319553 ATTCCATATGGAACACATGCAGG - Intronic
1152725266 17:81942003-81942025 GTCCCCTGTGGAGCCCCTGCCGG + Intronic
1153029135 18:697308-697330 GGTCCTTGTTGAGCACATGGTGG + Exonic
1158137417 18:54223438-54223460 GTTCCCTGGGGAGCAAATTTTGG + Intronic
1159392103 18:67806556-67806578 GATACCTATGGAGAACATGCAGG - Intergenic
1159957012 18:74525903-74525925 AGTCCCTGTGGAGAACTTGCTGG + Intergenic
1161280013 19:3441008-3441030 GTTCCCTGTGTTGCCCAGGCTGG + Intronic
1161949944 19:7462372-7462394 GTTCCCTGAGGAGCCCACCCCGG - Intronic
1163464065 19:17455922-17455944 GTTCTCAGTGGAGCGCCTGCCGG - Exonic
1164857428 19:31535900-31535922 CATCCCTGTGGAGCACAGACTGG - Intergenic
1167223296 19:48218232-48218254 GATACATGTGGAGGACATGCAGG + Intronic
925863577 2:8203475-8203497 GTTTCCTGGGGAGCAGATCCTGG - Intergenic
926125246 2:10267876-10267898 GTTCCCTGAGGAGCAGGTGGAGG - Intergenic
926222473 2:10945194-10945216 GATCCATGTGCAGAACATGCAGG + Intergenic
926313944 2:11696087-11696109 GATCCATGCGGAGAACATGCAGG + Intronic
926330020 2:11816780-11816802 GATCCATGTGCAGAACATGCAGG + Intronic
927842006 2:26450762-26450784 GTTACATGTGCAGAACATGCAGG + Intronic
933814963 2:86059336-86059358 GTTCCCTTTGGAGGACTTGGTGG + Intronic
935490167 2:103709728-103709750 GTTACATGTGCAGGACATGCAGG + Intergenic
936573558 2:113635487-113635509 TTTCCCTAGGGGGCACATGCTGG + Intronic
937682720 2:124661897-124661919 GTTACATGTGCAGAACATGCAGG + Intronic
938278224 2:130046621-130046643 GATACATGTGGAGAACATGCAGG - Intergenic
939050681 2:137303841-137303863 GATCCATGTGCAGAACATGCAGG + Intronic
939663250 2:144917297-144917319 GTTCCCATTGTAGCACATGGAGG + Intergenic
944988183 2:205203486-205203508 GATACATGTGGAGAACATGCAGG + Intronic
946059451 2:216929219-216929241 GATACGTGTGGAGGACATGCAGG + Intergenic
946326454 2:218986914-218986936 GTTCCCTGTGGACCAAACTCAGG + Intergenic
947019263 2:225656503-225656525 GCTGCCTCTGGAGCAGATGCAGG + Intergenic
1169198582 20:3696760-3696782 GTTCCATGGGGAGCACCTCCTGG - Exonic
1171194897 20:23189360-23189382 GTGTCCTGTGGAGCAGAGGCAGG + Intergenic
1175691283 20:61067645-61067667 GTGGCCTGTGCAGCACATGTGGG - Intergenic
1177022474 21:15880398-15880420 GGTCCATGTGCAGGACATGCAGG + Intergenic
1177951478 21:27543316-27543338 GATACATGTGGAGAACATGCAGG - Intergenic
1178433789 21:32539505-32539527 GTTCCATGGGGAGGACCTGCAGG - Intergenic
1178505089 21:33155747-33155769 GTTTCCTGTGGAATGCATGCTGG - Intergenic
1178756075 21:35351087-35351109 GTTCCCTGTGGAGCATCTATTGG - Intronic
1179123480 21:38570274-38570296 CTTGCCTGTGTGGCACATGCTGG - Intronic
1179315116 21:40237247-40237269 GGTACATGTGGAGAACATGCAGG + Intronic
1179583603 21:42360877-42360899 GCTCACTGTGGAGCAGAAGCTGG - Intergenic
1184067048 22:42126988-42127010 GTTCCCTGGGCAGGAGATGCAGG + Exonic
1184069773 22:42140692-42140714 GTTCCCTGGGCAGGAGATGCAGG + Intergenic
1185229694 22:49673036-49673058 CTTCTCTGTGGAGAAGATGCTGG - Intergenic
950764816 3:15265899-15265921 GTGCCCAGTGGTGCCCATGCGGG - Intronic
952386058 3:32842615-32842637 CTTCTCTGTGAGGCACATGCTGG - Intronic
952518547 3:34130764-34130786 GCTTCCTGTGGAACACAGGCTGG - Intergenic
953992668 3:47496236-47496258 GTTCCCAGTGGAGCAGGTCCTGG - Intronic
957459507 3:80497952-80497974 GTGCTCTGTGGAGCCCATGGGGG - Intergenic
960786129 3:121374016-121374038 GTTCCCTGGGGGGCACATGCAGG - Intronic
963662313 3:148142329-148142351 GTTACATGTGCAGGACATGCAGG - Intergenic
968503836 4:963038-963060 GATCCCCGTGGAGCTCCTGCCGG + Intronic
969573750 4:8024783-8024805 GTTCCCTCAGGAGTACATTCTGG + Intronic
971185367 4:24370796-24370818 GATCCATGTGCAGAACATGCAGG + Intergenic
972481803 4:39503895-39503917 GTTCATTGTGGAGCCCATCCAGG + Exonic
972831953 4:42824246-42824268 GATACCTGTGCAGAACATGCAGG - Intergenic
973303472 4:48616176-48616198 GGTACATGTGCAGCACATGCAGG - Intronic
975721605 4:77253909-77253931 GTTCCCTGTGTAGGATTTGCAGG + Intronic
978051436 4:104204964-104204986 GATACCTGTGCAGAACATGCAGG - Intergenic
979141355 4:117180020-117180042 GATCCATGTGCAGAACATGCAGG + Intergenic
980116877 4:128687708-128687730 TTTCCCTGTGTTGCACAGGCTGG - Intergenic
980239321 4:130153004-130153026 GGTACCTGTGCAGGACATGCAGG + Intergenic
980651318 4:135719556-135719578 TTTCCCTGTGTAGCACATAAAGG + Intergenic
980801948 4:137763109-137763131 GATACATGTGCAGCACATGCAGG + Intergenic
981029056 4:140105702-140105724 GTTGCCTGTGGGGGACATGGAGG + Intronic
982371329 4:154636978-154637000 GATCCATGTGCAGAACATGCAGG - Intronic
983484719 4:168319828-168319850 GTTCCCTGTGGAGCAGTGCCTGG - Intergenic
987582559 5:19813248-19813270 GTTACATGTGCAGAACATGCAGG - Intronic
987853490 5:23387623-23387645 CTTCCCTGAGGTCCACATGCCGG - Intergenic
994283946 5:97940836-97940858 TTTCCCTGTGTAGCCCAGGCTGG + Intergenic
995666700 5:114550523-114550545 GATACCTGTGCAGAACATGCAGG - Intergenic
995839326 5:116428715-116428737 CTTTCCTGTGAAGCACACGCAGG - Intergenic
1000737762 5:164927183-164927205 GGTACCTGTGCAGAACATGCAGG + Intergenic
1003406954 6:5833844-5833866 GTTACCTGTGGGGCATGTGCTGG + Intergenic
1004752397 6:18576221-18576243 GATACCTGTGCAGGACATGCAGG + Intergenic
1005000361 6:21233749-21233771 GATGCCTATGTAGCACATGCTGG - Intergenic
1005387238 6:25297476-25297498 GGTCTCTGTGGAGAACATGTTGG + Intronic
1005983598 6:30856241-30856263 GTTTCCTGTGGACCACAGGTGGG - Intergenic
1008086230 6:47247627-47247649 GTTCCCTCTGCAGCAGAGGCAGG + Intronic
1009465168 6:63959984-63960006 GATACATGTGGAGAACATGCAGG - Intronic
1009874696 6:69491205-69491227 GTTTGGTGTTGAGCACATGCTGG - Intergenic
1011970768 6:93219982-93220004 GTGCTCTGTGCAGAACATGCTGG - Intergenic
1012649352 6:101734396-101734418 GTTCTCTGTTCAGCACATGAGGG + Intronic
1014110027 6:117609942-117609964 GTTTCCAGTGGAGAACATGGTGG + Intergenic
1016317328 6:142805257-142805279 GTTCCCTCTTGTGCACAGGCTGG - Intronic
1017637279 6:156455926-156455948 GTTCCCTCTGGAGGATCTGCAGG + Intergenic
1018457024 6:163961960-163961982 GTTACCAGGGGAGCACATGGCGG + Intergenic
1019355513 7:576806-576828 CTTCCCTGAGGGGCACATTCAGG - Intronic
1020448212 7:8292311-8292333 GTTTCCTGTGGAGCAGAGGTGGG - Intergenic
1021622365 7:22561538-22561560 GTTCCAACTTGAGCACATGCTGG + Intronic
1022435535 7:30380717-30380739 GATACATGTGGAGAACATGCAGG + Intronic
1022470875 7:30681396-30681418 GTTTCGTGGGGAGGACATGCAGG - Intronic
1022616231 7:31933191-31933213 GTTACATGTGCAGAACATGCAGG - Intronic
1024220454 7:47282572-47282594 GTGCCCTGTGTGGCACACGCAGG - Intronic
1024967054 7:55033345-55033367 GCTCCCTGTGAAGCACAGGGAGG + Intronic
1025021670 7:55485254-55485276 GTTCCCTGTGGAGGAGAAGCTGG - Intronic
1030226387 7:107156227-107156249 GATACATGTGGAGAACATGCAGG - Intronic
1031534825 7:122920587-122920609 GTTACATGTGCAGAACATGCAGG + Intergenic
1032007813 7:128317908-128317930 GTTCCCTTAGGACCACTTGCAGG - Intronic
1032266957 7:130376210-130376232 GATCCCTGTAGAGAACATGATGG - Intergenic
1033638533 7:143237636-143237658 GTTCCCTGGTAGGCACATGCAGG + Intergenic
1034249654 7:149677905-149677927 GTTCCCTGTGGACCAAATTGTGG + Intergenic
1034289958 7:149922241-149922263 GTTCATTGTGGAGGACAGGCGGG + Intergenic
1034434299 7:151055782-151055804 GGTCCCTGTGTAGCACATTGCGG + Exonic
1034497766 7:151432440-151432462 GTGCCCTGTGGGGTCCATGCTGG + Intronic
1034661105 7:152770596-152770618 GTTCATTGTGGAGGACAGGCGGG - Intronic
1036427197 8:8655576-8655598 GTGCGCTGTGGGGCACAGGCAGG - Intergenic
1036432875 8:8706074-8706096 GTTCTCTGTGGTGCAGTTGCTGG - Intergenic
1038518827 8:28211419-28211441 GGTCCCTGTGCAGGATATGCAGG - Intergenic
1039214627 8:35256351-35256373 GGTACCTGTGCAGAACATGCAGG + Intronic
1039984969 8:42439382-42439404 GTTCCCTGGGGAGGACCAGCTGG - Intronic
1041743694 8:61183282-61183304 GATACATGTGCAGCACATGCAGG - Intronic
1042172871 8:66009245-66009267 GTCCCCTGTGTAGAACATGGTGG + Intergenic
1043432858 8:80211409-80211431 AATCACTGTGGAGCACATACTGG + Intronic
1045124851 8:99078579-99078601 GTGCCCTGTGTGGCATATGCAGG + Intronic
1045505227 8:102773501-102773523 GATGCCTGTGGAGCCCCTGCTGG - Intergenic
1046085854 8:109434207-109434229 GATACCTGTGCAGAACATGCAGG - Intronic
1050356260 9:4785621-4785643 GATACCTGTGCAGAACATGCAGG - Intergenic
1052327064 9:27226682-27226704 GATACATGTGGAGAACATGCAGG - Intronic
1052599762 9:30610346-30610368 GTTACATATGGAGAACATGCAGG - Intergenic
1053379093 9:37634784-37634806 GATCCATGTGCAGAACATGCAGG + Intronic
1054143958 9:61549163-61549185 TTTCCCTCTTGAGCACATGCAGG + Intergenic
1054463737 9:65480519-65480541 TTTCCCTCTTGAGCACATGCAGG + Intergenic
1055408285 9:75999093-75999115 GTTACATGTGTAGAACATGCAGG + Intronic
1056381673 9:86062343-86062365 GTGCCCTGTGCAGGAGATGCTGG - Intronic
1059952178 9:119477394-119477416 GATCCCTATGCAGAACATGCAGG + Intergenic
1061588652 9:131584205-131584227 GCTCCCACTGGAGCAAATGCTGG - Intronic
1061638001 9:131927608-131927630 GTTTGATATGGAGCACATGCTGG - Intronic
1062217466 9:135397040-135397062 GGTCCCTGTGGACCCCAGGCTGG - Intergenic
1185515493 X:696202-696224 GTTCCCTGTGGGGCCCACTCTGG + Intergenic
1185820292 X:3196407-3196429 GTTCCCAGTGAAGCAGAGGCTGG - Intergenic
1186091006 X:6048966-6048988 GATCCATGTGCAGGACATGCAGG - Intronic
1186512836 X:10143296-10143318 GATCCTTGTGGGGCACAGGCTGG - Exonic
1186636360 X:11409374-11409396 GTTCACTCAGGAGCACAAGCAGG + Intronic
1190232346 X:48591951-48591973 GATACCTGTGCAGAACATGCAGG - Intronic
1191752070 X:64553537-64553559 GATACCTGTGCAGAACATGCAGG - Intergenic
1191771059 X:64759101-64759123 GATACATGTGGAGAACATGCAGG + Intergenic
1191948536 X:66562595-66562617 GGTACCTGTGCAGAACATGCAGG - Intergenic
1192249990 X:69404101-69404123 GATACATGTGGAGGACATGCAGG + Intergenic
1192628437 X:72754894-72754916 GGTACCTGTGCAGAACATGCAGG + Intergenic
1192653270 X:72965919-72965941 GGTACCTGTGCAGAACATGCAGG - Intergenic
1192935271 X:75852110-75852132 GGTACATGTGGAGAACATGCAGG + Intergenic
1192963719 X:76155577-76155599 GATACCTGTGCAGAACATGCAGG - Intergenic
1193363326 X:80601005-80601027 GATACATGTGGAGAACATGCAGG - Intergenic
1197264279 X:124349252-124349274 CTTCCCTCTGCAGCACATTCTGG - Intronic
1200725169 Y:6660889-6660911 GATCCATGTGCAGAACATGCAGG - Intergenic