ID: 1136615880

View in Genome Browser
Species Human (GRCh38)
Location 16:31398063-31398085
Sequence ACTTCTACCCTGGAGCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136615880_1136615885 21 Left 1136615880 16:31398063-31398085 CCCTGCTGCTCCAGGGTAGAAGT 0: 1
1: 0
2: 1
3: 18
4: 118
Right 1136615885 16:31398107-31398129 TATTTTTTTCTTTTTAAGACAGG 0: 2
1: 43
2: 1575
3: 20505
4: 32303
1136615880_1136615886 22 Left 1136615880 16:31398063-31398085 CCCTGCTGCTCCAGGGTAGAAGT 0: 1
1: 0
2: 1
3: 18
4: 118
Right 1136615886 16:31398108-31398130 ATTTTTTTCTTTTTAAGACAGGG 0: 3
1: 122
2: 2230
3: 22981
4: 42504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136615880 Original CRISPR ACTTCTACCCTGGAGCAGCA GGG (reversed) Intronic
900727388 1:4225820-4225842 ACCTCTTCCCTGGACCATCATGG + Intergenic
901213311 1:7538858-7538880 ACTTTGACACTGGAGGAGCATGG + Intronic
902070062 1:13726872-13726894 ACTTCTATTCAGGGGCAGCAAGG + Intronic
902852301 1:19169405-19169427 ATTTCTACCCTGGAACAGATAGG + Intronic
906165301 1:43681589-43681611 ATTTCTAGCCTGGACCACCAAGG - Intronic
907063013 1:51450180-51450202 ACTGCTACCCTGCAGGAGCCAGG + Intronic
907165189 1:52404327-52404349 ACCTCTAACCTGCACCAGCAGGG + Exonic
910227163 1:84947665-84947687 GCTTCCACTCTGGGGCAGCATGG - Intronic
912795628 1:112691742-112691764 ACTTGTTCCCTGAAGAAGCATGG - Exonic
913279127 1:117169011-117169033 ATGTCTACACTGGAGAAGCATGG + Intronic
915889027 1:159753787-159753809 CCTTCTTCCCTGAAACAGCAGGG - Intergenic
916811123 1:168306655-168306677 GCTTCTTCCCTGGAGGAGCTCGG + Intronic
916822202 1:168410440-168410462 ACTCCAACCCTGGAGCATAATGG - Intergenic
919904730 1:202070430-202070452 TCATCTACCCTGGAGCACCCTGG + Intergenic
921313618 1:213870067-213870089 ACTTCTACAGTAGAGCAGTAGGG + Intergenic
922471687 1:225881133-225881155 CCTCCTACCCTGGAGCACAAAGG + Intronic
922639678 1:227216392-227216414 TTTTCCACCCTGCAGCAGCATGG - Intronic
923790023 1:237104082-237104104 ATTTCTCCTCTGGACCAGCAAGG + Intronic
924074372 1:240318125-240318147 ACTTCCACCCAGCAGCAACAAGG - Intronic
1062968463 10:1628100-1628122 ACATCTACCCTGGAGCACCCTGG + Intronic
1063077363 10:2730721-2730743 GGGTCTACCCTGGAGCAGAAAGG + Intergenic
1064799126 10:19049017-19049039 AATTCTACACTGGCTCAGCAAGG + Exonic
1071229051 10:83564223-83564245 TCTTCTTCCCTGGCTCAGCAAGG + Intergenic
1073894565 10:108140041-108140063 ACTTATACCCTGAACCAGCATGG - Intergenic
1075446722 10:122518452-122518474 ACTGCTGCCCTGGACCAGCTGGG + Intergenic
1077424355 11:2467379-2467401 CCCTCTTCCCTGGAGCAGCCAGG + Intronic
1078057266 11:8018743-8018765 ACTTCCACCCTGGGGAAGAAGGG + Intergenic
1080304760 11:30824324-30824346 ACTTGTGCCCTGGAGGAGGAGGG - Intergenic
1081214210 11:40374278-40374300 AATTCTACCCAGGAGGATCAGGG - Intronic
1083879638 11:65541608-65541630 ACTCCCACCCAGGACCAGCACGG - Exonic
1084572642 11:69968791-69968813 ATTTCTGTCCAGGAGCAGCAGGG + Intergenic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1085624438 11:78061246-78061268 TGTTCTGCCCTGGAGAAGCAAGG + Intronic
1087173409 11:95074136-95074158 ACTTCTTCCCTGCAGCAGTAAGG + Intergenic
1088621084 11:111684647-111684669 ACTTCTACACTGGATGAGCTGGG - Intronic
1088830248 11:113530598-113530620 GATTCTACCCTGCAGCAGAAGGG - Intergenic
1089018692 11:115188609-115188631 ATTTCTACCCTGATGCAGCAGGG + Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1096564545 12:52467705-52467727 ACTTGAACCCAGGAGCAGGAGGG - Intergenic
1097774022 12:63625104-63625126 ACTTCTACCCTGGCTTGGCATGG + Intronic
1102611368 12:114115331-114115353 TCCTCCAACCTGGAGCAGCATGG + Intergenic
1106554366 13:30797504-30797526 GCTACTAGCCTGTAGCAGCATGG + Intergenic
1122403567 14:101482138-101482160 ATGTCTTCCCTGGAGCAGCCTGG - Intergenic
1122987841 14:105220795-105220817 GCCTCGGCCCTGGAGCAGCATGG - Intronic
1124344398 15:28912515-28912537 ACTTATCTCCTGGAGCATCAGGG + Intronic
1126097714 15:45100999-45101021 GATTCTGGCCTGGAGCAGCAGGG + Intronic
1126145484 15:45469411-45469433 ACTTCCCCTCTGGAGCAGAAAGG - Intergenic
1126434988 15:48627818-48627840 ACATCTTCCCTGGAGCTGGAAGG - Intronic
1129302512 15:74633702-74633724 ACTTGTGTCCTGGAGCAGCTGGG + Intronic
1132880177 16:2158668-2158690 CCTTCTGCCCTGCAGCAGCAGGG - Intronic
1136615880 16:31398063-31398085 ACTTCTACCCTGGAGCAGCAGGG - Intronic
1137459869 16:48650366-48650388 ACTTTTTCCCTGGAACAGGAAGG + Intergenic
1142652324 17:1363134-1363156 ACTTCTAGTATGGAGCAGCATGG - Intronic
1143786193 17:9257532-9257554 ACTTCTGCCCTGTAGCTGCAGGG + Intronic
1144501368 17:15788462-15788484 ACTTCTCCCCTGAAGAAGAAAGG - Intergenic
1144787058 17:17837753-17837775 ACTTATTCCCAGGAGCAGCCAGG + Intergenic
1145163543 17:20591136-20591158 ACTTCTCCCCTGAAGAAGAAAGG - Intergenic
1148212308 17:45815985-45816007 ACATCTACCCTGGCCCTGCAGGG - Intronic
1148477952 17:47941575-47941597 ACTTCTACCCCGGGGAAGGAAGG - Exonic
1148745567 17:49916146-49916168 TCATGTCCCCTGGAGCAGCACGG - Intergenic
1151464788 17:74277564-74277586 ACTTGGGCCCTGGAGCAGCTGGG - Intronic
1151963823 17:77420996-77421018 ATTTGAACCCTGGAGCAGCCTGG + Intronic
1152165978 17:78706449-78706471 ACTGCTAGCGTGCAGCAGCACGG - Intronic
1152741861 17:82021956-82021978 ACTTCAGCCCTGTAGAAGCAGGG - Intronic
1152817282 17:82415509-82415531 ACTCCTGCTCTGGAGCAGCTTGG - Exonic
1161537322 19:4828031-4828053 ACTGCTACCCTGTCCCAGCATGG - Intronic
1163095940 19:15057114-15057136 ACTTCCAGCCTGGTGCTGCAAGG - Exonic
1163621732 19:18364874-18364896 ACTTCTGGCCTGGAGCTTCAGGG + Exonic
1164666999 19:30046826-30046848 ACCTCAAACCTGGAGCAGCAGGG - Intergenic
1166328350 19:42065002-42065024 AGTTCTGCTCTGGAGGAGCACGG - Intronic
1168633939 19:57980153-57980175 ACTTCTAACCTGGAGAACCAAGG + Exonic
925414860 2:3662339-3662361 ACTTCCACCCTGGGTGAGCAGGG - Intronic
926561157 2:14418969-14418991 ACTTGTACCCTGGAGCTTCCAGG - Intergenic
929291646 2:40198846-40198868 CCTTCAACCCTGTATCAGCAGGG - Intronic
934602660 2:95669773-95669795 CAGTCCACCCTGGAGCAGCATGG - Intergenic
936536032 2:113311965-113311987 CAGTCCACCCTGGAGCAGCATGG - Intergenic
937609168 2:123839922-123839944 ACTTGTAGCCTGGACCAGCTTGG + Intergenic
937662846 2:124450690-124450712 ACTTCCAGCCTGGAGCAGAAGGG + Intronic
938713818 2:134000503-134000525 ACATCTACCCTAGAGCTGAAGGG + Intergenic
939667405 2:144968623-144968645 ACATCTTACATGGAGCAGCAGGG + Intergenic
939860958 2:147419934-147419956 ACTTCTTCTCTAGACCAGCATGG + Intergenic
948932690 2:241142166-241142188 ACTTCGACACTGGAGTAGGAGGG - Intronic
1171394662 20:24824232-24824254 ACTGCATCACTGGAGCAGCAAGG + Intergenic
1174182890 20:48686226-48686248 CCTTCTACCCTGGAGGACCAGGG + Intronic
1175753675 20:61515974-61515996 CATTCTACCCTGGAGCAGCCAGG - Intronic
1176904236 21:14480409-14480431 ACTTTTACCCGGGGGCTGCATGG - Intergenic
1177583835 21:23062842-23062864 AGCTCTCCTCTGGAGCAGCAAGG - Intergenic
1178367038 21:31996828-31996850 GCTTCTCTCCGGGAGCAGCATGG - Intronic
1180597511 22:16988355-16988377 TTTCCTACCCTGGAGCAGCCTGG + Intronic
1183982789 22:41552115-41552137 GCATATTCCCTGGAGCAGCAGGG - Intergenic
1184987445 22:48145372-48145394 ACTTGGCCCCAGGAGCAGCAGGG - Intergenic
950666346 3:14497593-14497615 ACTTCATCCCAGGAGCAGCAGGG + Intronic
952328288 3:32340430-32340452 ACCTCTTTCCTGGAGCATCAAGG - Intronic
954597437 3:51838491-51838513 ACTACTACCCAGGAGCACAAAGG - Intergenic
964275202 3:155002269-155002291 ACTTCTACACAGGAGTAGAATGG + Intergenic
969871706 4:10108809-10108831 ATTTCTAGCTTGGAGCATCAGGG - Intronic
971483820 4:27139601-27139623 ACTTGAACCCTGGAGGAGGAGGG - Intergenic
975825143 4:78311577-78311599 ATTTATACCCAGGAGCAGAATGG + Intronic
980322927 4:131302819-131302841 AATTCTTAGCTGGAGCAGCATGG - Intergenic
982236733 4:153258120-153258142 TCCTCTACCCTGGGGCAGCGAGG - Intronic
990504255 5:56429217-56429239 ACTGCTCCCCTGGGGCAGGACGG + Intergenic
990969805 5:61492718-61492740 ACTTCTACCCTGAATCACAAAGG - Intronic
991093256 5:62712970-62712992 ACTTGTACCCGGGAGGAGGAGGG + Intergenic
991400286 5:66244542-66244564 AATTTTACTCTGGAGCAGGAAGG - Intergenic
991422829 5:66458606-66458628 ACTTCTAAACTGGCACAGCATGG + Intergenic
996636970 5:125703738-125703760 ATTCCTTCCCTGGAGCAGCATGG + Intergenic
996817421 5:127589287-127589309 ATTTCTTCCCGGGAGCAGTATGG + Intergenic
997142790 5:131400643-131400665 ACCGCTTCCCTGGTGCAGCATGG + Intergenic
997646810 5:135487436-135487458 ACTTCTCCCCTGGAGCAGCCTGG + Intergenic
999720826 5:154398201-154398223 ACTCCTGCGGTGGAGCAGCAAGG + Intronic
1002085763 5:176774556-176774578 CCTTCCACCTTCGAGCAGCAGGG - Intergenic
1003984406 6:11420283-11420305 ACTTGTAGCCTGGATCTGCAAGG - Intergenic
1004641738 6:17522395-17522417 AGTTCTTCCGTGAAGCAGCAGGG + Intronic
1004868618 6:19879737-19879759 AATTCTAACCTGGAGCTGTAGGG + Intergenic
1006027573 6:31157408-31157430 ACCTCTGGCCAGGAGCAGCAGGG - Exonic
1009280557 6:61745498-61745520 GGTTCTATCCTGAAGCAGCAAGG - Intronic
1009774930 6:68194490-68194512 TCACCTACCCAGGAGCAGCAAGG + Intergenic
1012864176 6:104597632-104597654 GCTTCTAGCCTGGATCAGCCAGG + Intergenic
1013995916 6:116307760-116307782 ACTTCTTTCCTTGTGCAGCATGG - Intronic
1015788479 6:136942679-136942701 ATTTCTAGTCTGGAGGAGCATGG - Intergenic
1017217223 6:151922913-151922935 AATTCTAACCTGCAACAGCATGG + Intronic
1019606312 7:1911957-1911979 ACTTCTGCCCTGCAGCTGCATGG - Intronic
1020858576 7:13459468-13459490 ATTTCAACCCTGGAGCAGAGTGG - Intergenic
1023073802 7:36463211-36463233 ATTTCTACCCTTGAACAGCAAGG - Intergenic
1024609835 7:51054960-51054982 CTTTCTTCCCTGGAGCAGCCTGG + Intronic
1029960826 7:104687855-104687877 ATTTCTACCCTCTAGCAGAATGG + Intronic
1031716992 7:125121720-125121742 ACTATTACCCTGAGGCAGCAAGG + Intergenic
1035068690 7:156125527-156125549 ACTTCTACTGTTGGGCAGCACGG - Intergenic
1038170082 8:25123411-25123433 CCTTCTATCCTGTAGCTGCAGGG + Intergenic
1040583278 8:48715472-48715494 TCTTCTACCCTGGCACAGCTTGG + Intronic
1045508055 8:102792685-102792707 GCTTCTACCCTGGGGAGGCAGGG - Intergenic
1049127317 8:140803789-140803811 GCTGCTCCCCTGGGGCAGCATGG - Intronic
1049555897 8:143281857-143281879 ACCTCCTCCCTGGAGCAGGAGGG + Intergenic
1058588115 9:106532147-106532169 CCTACTTCCCTGGAGCAGCATGG - Intergenic
1060562176 9:124554879-124554901 AATTCTACCCTGTAGGAGCACGG + Intronic
1060647397 9:125292683-125292705 AAATCTACCCTGGACCAGCCGGG - Intronic
1061158855 9:128881990-128882012 ACTTCCGCCCCGAAGCAGCAGGG + Exonic
1061249907 9:129420548-129420570 GCTTGAACCCAGGAGCAGCACGG + Intergenic