ID: 1136617985

View in Genome Browser
Species Human (GRCh38)
Location 16:31410400-31410422
Sequence TCCCCACAGCCCCCAGGAAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 506}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136617985_1136617989 -4 Left 1136617985 16:31410400-31410422 CCTCTTCCTGGGGGCTGTGGGGA 0: 1
1: 0
2: 7
3: 47
4: 506
Right 1136617989 16:31410419-31410441 GGGAGCTTTAGCTGGTCTGGAGG 0: 1
1: 0
2: 2
3: 14
4: 115
1136617985_1136617988 -7 Left 1136617985 16:31410400-31410422 CCTCTTCCTGGGGGCTGTGGGGA 0: 1
1: 0
2: 7
3: 47
4: 506
Right 1136617988 16:31410416-31410438 GTGGGGAGCTTTAGCTGGTCTGG 0: 1
1: 1
2: 2
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136617985 Original CRISPR TCCCCACAGCCCCCAGGAAG AGG (reversed) Exonic
900610249 1:3541676-3541698 TTCCCACTGTCCCCAGGGAGAGG - Intronic
900719711 1:4167370-4167392 TCCACACAGCCAGCAGGCAGCGG - Intergenic
901209548 1:7516748-7516770 TCCCCACAGGCCAGAAGAAGGGG + Intronic
901637991 1:10679308-10679330 GCACCACATGCCCCAGGAAGCGG + Intronic
901800201 1:11704138-11704160 TCCCCTCAACCCCCAGGACAAGG + Intronic
902117047 1:14129697-14129719 TCCCAGCAGCCCACAGGAAAAGG + Intergenic
902270943 1:15304625-15304647 TCCCCACAGAAAACAGGAAGAGG + Intronic
902568832 1:17333507-17333529 TCCCCAGATCCCCCAGGACCCGG + Intronic
902725680 1:18334578-18334600 TCCTCACGGCTCCCTGGAAGTGG + Intronic
902763533 1:18599743-18599765 TCCCCTCAGCACCCAGGATTGGG - Intergenic
902917640 1:19648322-19648344 GCCTCCCAGCCCCCAGGAAAGGG - Intronic
903578060 1:24351385-24351407 TCCCTGCAGCCCCTGGGAAGGGG + Intronic
903745768 1:25585699-25585721 TCCCAGCAGACCCAAGGAAGGGG + Intergenic
903852478 1:26316453-26316475 TCCCCCCAGGCCCCAGGAGTTGG - Intronic
904264383 1:29310038-29310060 TCCCCAGAGCCCCCAAGCTGAGG - Intronic
904265668 1:29317304-29317326 ACCCCACACCCTCCAAGAAGCGG - Intronic
904909947 1:33927229-33927251 AGTCCAAAGCCCCCAGGAAGAGG - Intronic
905257256 1:36692964-36692986 GCCCCAGAGCTCCCAGGAAATGG + Intergenic
905461205 1:38124055-38124077 CACCCACAGCTCCCAGAAAGGGG + Intergenic
905889468 1:41510506-41510528 TCCCCCAAGCCCTCAGGAAGTGG - Exonic
906076270 1:43054471-43054493 TCCCAGCAGCCCCCATGAGGAGG + Intergenic
906711071 1:47930329-47930351 CCCCAACACCCCTCAGGAAGAGG - Intronic
907823130 1:57990136-57990158 TCTCCTCAGCTCCCAGGAAATGG + Intronic
908519882 1:64931446-64931468 TCCCCACCTCCCCCAGCAACAGG + Intronic
908648873 1:66310359-66310381 TCCCCGCTGCCCTCAGGAGGTGG + Intronic
909664919 1:78121919-78121941 TCCTCACAGCCTCCAGCAAAAGG - Intronic
912521706 1:110250245-110250267 TCCAGACAGACCCCTGGAAGGGG + Intronic
914460415 1:147878366-147878388 TCCCCAGAGCCTCCAGGGTGAGG + Intergenic
914900321 1:151707986-151708008 TCCCCAAAGCCCTCAGGACCTGG + Intronic
914944310 1:152050632-152050654 CTCCCAAAGCCCCCATGAAGTGG - Intergenic
915087190 1:153396825-153396847 TCCCCACTGCCCACTGGGAGGGG + Intergenic
915279908 1:154815262-154815284 TGCCCAAACCCCCCAGGTAGGGG - Intronic
915590240 1:156866528-156866550 TCCCTACAGAGCCCAGGACGGGG - Intronic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916495434 1:165342490-165342512 TCCCCCCAGCCCCCAGAAGAAGG - Intronic
916647108 1:166797151-166797173 TCCCCCCTGCTCCCAGGAGGAGG + Intergenic
919437531 1:197580533-197580555 TGCCCCCAGACCTCAGGAAGAGG - Intronic
919791940 1:201297347-201297369 GCCCCACAGACCTCAGGGAGAGG + Intronic
920074050 1:203324226-203324248 CACCCACATCTCCCAGGAAGTGG - Intergenic
920106021 1:203554262-203554284 CCACCACAGCCAGCAGGAAGTGG + Intergenic
920180856 1:204131004-204131026 ACCCCTCAGCCCCCACGCAGGGG + Intergenic
920341754 1:205279557-205279579 TTCCCACAGCCCCCAGGGCTTGG - Intergenic
920499306 1:206476422-206476444 CCCCCAGAGCCCCCATGAGGGGG + Intronic
921585011 1:216935987-216936009 ACCCCTCATCCTCCAGGAAGGGG - Intronic
922798969 1:228355449-228355471 TCCCCAGAGCCAGCAGGATGGGG - Intronic
922825069 1:228512079-228512101 TCCCCAAAGCTTCCAAGAAGAGG - Intergenic
922905238 1:229169018-229169040 CCTCCTCAGCCCCCAGGGAGGGG - Intergenic
923147356 1:231207546-231207568 TCCCCACTGCCTCCAAGAAGAGG + Intronic
923671217 1:236042907-236042929 TCCCCACTGCCTCCAGGGAGGGG + Intronic
924938466 1:248792192-248792214 TCCCCAAAGCTCCCAGTCAGGGG + Intergenic
1062842197 10:680093-680115 GTCCCACAGCCACCAGGAGGAGG + Intronic
1063048940 10:2424382-2424404 AGCCCACAGATCCCAGGAAGAGG - Intergenic
1064193714 10:13228838-13228860 TCCCCACAGCCCCAAGCCAATGG + Intronic
1064294519 10:14066300-14066322 CCCCCACACCCCCCACCAAGAGG - Intronic
1064642527 10:17428990-17429012 TCCCCACACACAACAGGAAGGGG - Intronic
1065190059 10:23199872-23199894 ACCCCACATGCCACAGGAAGCGG - Intergenic
1065968095 10:30784990-30785012 TCCCCAGAGCGCGCAGGGAGCGG + Intergenic
1067469011 10:46522986-46523008 TTCCCACACACCCCAGCAAGGGG + Intergenic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1070252451 10:74784817-74784839 TACCCTCAACCTCCAGGAAGAGG + Intergenic
1070813232 10:79308740-79308762 TGCCCTCAGGGCCCAGGAAGGGG - Intronic
1071240439 10:83699099-83699121 TCCCCACATCCACCAGCGAGTGG - Intergenic
1072235190 10:93447612-93447634 TTCTCTCAGCCCCGAGGAAGGGG - Intronic
1072781725 10:98256034-98256056 TGAGCACAGCCCCCAGGGAGAGG - Intronic
1072808935 10:98445045-98445067 TCCTCCCAGCCCCCACCAAGGGG - Intronic
1073458085 10:103649841-103649863 TCCTCCCTTCCCCCAGGAAGGGG - Intronic
1073995146 10:109307114-109307136 TTCTCTCAGCCCCGAGGAAGGGG + Intergenic
1074861209 10:117511976-117511998 GCCCCCCAGCCCCCAGCATGGGG + Intergenic
1075710613 10:124528687-124528709 TCCCCACTGCCCACGGGAGGAGG + Intronic
1075726190 10:124612062-124612084 TGCCCACAGCCCCTAGGATGAGG + Intronic
1076719575 10:132387248-132387270 ACCCCAAAGCCACCAGGGAGGGG - Intergenic
1076887695 10:133270117-133270139 CCCCCAAAGCCCCTGGGAAGTGG + Intronic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077067118 11:646542-646564 TCTGCACAGGCCCCAGGGAGTGG - Intronic
1077173923 11:1180268-1180290 TCCGCCCAGCCCCCAAGCAGCGG - Intronic
1077236421 11:1484099-1484121 GCCCCACGGCCCACAGGAATGGG + Intronic
1077488077 11:2848189-2848211 CCCCCACACCGGCCAGGAAGAGG - Exonic
1077888420 11:6402577-6402599 TCCCCCCAGCCCCCAGACATGGG + Exonic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1079172062 11:18105855-18105877 TCCCTACATCCCCCAGGCACCGG - Intronic
1079241605 11:18726044-18726066 TCCCCTCCTCCCTCAGGAAGGGG - Intronic
1081672381 11:44949545-44949567 TCCCCCCGGGCTCCAGGAAGAGG + Intronic
1082672787 11:56056187-56056209 TTCTCTCAGCCCCAAGGAAGGGG + Intergenic
1082991221 11:59208662-59208684 TCCCCACAGACCCCAGGCTAAGG + Exonic
1083688433 11:64391647-64391669 TCCCCACTGCCCCCAGCAGAGGG + Intergenic
1083870933 11:65488142-65488164 TCCCCACAGGCCTGAGAAAGGGG + Intergenic
1083942331 11:65903155-65903177 ACCCCACCGCCCCCAAGCAGTGG + Intergenic
1084434024 11:69127531-69127553 TCCACCCAGCACCCAGGAGGAGG + Intergenic
1085509430 11:77080654-77080676 GCCACACAGCCTCCTGGAAGAGG + Intronic
1085521957 11:77144328-77144350 TGCCCAGAGCCCCCAGGGTGGGG + Intronic
1088754980 11:112878283-112878305 TCCCCACAGACCTGAGGAAGAGG + Intergenic
1089350088 11:117817153-117817175 TCCTCACAGCACCCATGAACAGG - Intronic
1089398740 11:118152556-118152578 TCCCCCCACCCCCAAAGAAGGGG - Intronic
1089532814 11:119142553-119142575 ACCCCACAACCACCAGGAAGGGG + Intergenic
1090277527 11:125430279-125430301 TCCCCAAAGCCCTAAAGAAGGGG + Intronic
1091581334 12:1792123-1792145 TCACAACAGCCCCCTGAAAGTGG - Exonic
1091716824 12:2783578-2783600 CCCACACAGCCAGCAGGAAGAGG - Intergenic
1091888297 12:4032165-4032187 CGCCCACAGGCCCCAGGAAGGGG - Intergenic
1091931798 12:4402494-4402516 TCCACAGAGTCCCCAGGCAGTGG - Intergenic
1092261086 12:6953704-6953726 TTCCCTCAGGCCCCAGGATGAGG - Intronic
1093022192 12:14214109-14214131 TCCCCACAGTCCTCAAGAAAAGG + Intergenic
1094828056 12:34287365-34287387 CCCCCACAGACCCCATGCAGGGG - Intergenic
1094828891 12:34290873-34290895 ACCCCACGGACCCCAGGCAGGGG + Intergenic
1095973901 12:47926197-47926219 TTCCCAGAGCCTCCAGAAAGAGG + Intronic
1096620195 12:52859736-52859758 TCCCCATAGCCCCCAGCACCAGG - Intergenic
1096626777 12:52900677-52900699 TCTCCTCATCCCCCAGGATGTGG - Exonic
1099974544 12:89532826-89532848 TCCCCACAGCCCCTGGCAAATGG - Intergenic
1102629765 12:114267599-114267621 TCACCACAGACCCTATGAAGAGG - Intergenic
1103008230 12:117438766-117438788 TCACCAGTGCCTCCAGGAAGTGG - Intronic
1103914658 12:124370060-124370082 TCCCCACAGCCAGCAGGAGCGGG + Intronic
1103984991 12:124761009-124761031 GCCGCACAGGCACCAGGAAGGGG + Intergenic
1104013757 12:124949338-124949360 GCCCCACCAGCCCCAGGAAGGGG + Intronic
1104030994 12:125065674-125065696 CGCCCACAGCCGCCCGGAAGCGG - Exonic
1107823354 13:44305948-44305970 TCACCACAGCCCCTGGAAAGAGG + Intergenic
1110736350 13:78941546-78941568 TGCCGGCAGCCCCCAGGAACTGG + Intergenic
1112423654 13:99276642-99276664 ACCCACCAGCCTCCAGGAAGTGG - Intronic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113677625 13:112218014-112218036 TTCACACAGCCTCCACGAAGTGG + Intergenic
1114126243 14:19729801-19729823 TCCCCAAAGCCCACTGGGAGAGG - Intronic
1114597546 14:23926245-23926267 GACCCACAGACCCCAGGAGGAGG - Intergenic
1114620068 14:24090460-24090482 TACATACTGCCCCCAGGAAGCGG + Intronic
1116428431 14:44818640-44818662 TCACCACAACTCCCAGGTAGTGG + Intergenic
1116756642 14:48957091-48957113 TCCACAAAGCACCCAGGTAGTGG - Intergenic
1118877560 14:69797772-69797794 TCCTCTCAGCTCCCAGGAAAAGG - Intergenic
1119432240 14:74575930-74575952 AACCCACAGCCCCAGGGAAGGGG + Intronic
1119666986 14:76491777-76491799 TGCCCACAGGCCCCAGGGATGGG - Intronic
1119786935 14:77320966-77320988 TCCCAGCAGCCCCCAGGTACGGG + Exonic
1120581529 14:86256208-86256230 TTCTCTCAGCCCCGAGGAAGGGG - Intergenic
1121501773 14:94443746-94443768 TCACAACAGCCCCAAGGAGGGGG - Intronic
1121631164 14:95422849-95422871 TCCCCAAGACTCCCAGGAAGGGG + Intronic
1122266282 14:100548429-100548451 TACCCACAGCCCTCGGGAAGAGG + Intronic
1122812719 14:104296965-104296987 TCACCACAGCCCCCACCCAGTGG - Intergenic
1202906221 14_GL000194v1_random:73681-73703 TCCCCACTGCCCCTGGGACGGGG + Intergenic
1125731974 15:41897601-41897623 TCTCCCCAGCTCCCAGGGAGGGG - Exonic
1126640613 15:50821681-50821703 TCCCCACAGGCACCAGGCAAGGG - Intergenic
1127180441 15:56410638-56410660 CCCCCACACCTCCCAAGAAGAGG + Intronic
1127235727 15:57049078-57049100 ATCCCACGGCCCCCAGAAAGTGG - Intronic
1127367120 15:58301427-58301449 TCTTCATAGCCCCCAGGAACTGG - Intronic
1127563102 15:60159990-60160012 TTCCCACAGCCACCTGGATGTGG + Intergenic
1128577168 15:68784038-68784060 TTTCCAAAGCCCCCAGGGAGTGG - Intronic
1129107935 15:73322056-73322078 TCCACTCTGCCCCCAGAAAGGGG - Exonic
1129693688 15:77728501-77728523 TCCTCCCAGCCTCCAGGGAGGGG + Intronic
1130149511 15:81300368-81300390 TCCCTGCATCCCCAAGGAAGGGG + Exonic
1131046857 15:89322002-89322024 TCCCCACAGCTCCCAGATGGTGG - Exonic
1131540990 15:93275190-93275212 TCCCCACAGCCCTTATGAGGAGG - Intergenic
1131853692 15:96569585-96569607 TCCCCACAGCCCTCCGTGAGGGG + Intergenic
1132075157 15:98813582-98813604 TACTCACAGTCCCCAAGAAGAGG - Intronic
1132383783 15:101385391-101385413 TGCCCACAGCAACCAGGAACGGG + Intronic
1132577571 16:671018-671040 TCCCCACACTCCCCAGGCACAGG - Intronic
1132668861 16:1094652-1094674 ACCCAACAGCCCACAGGGAGTGG - Intronic
1133220859 16:4318637-4318659 TCCCTCCAGGCCCCAAGAAGGGG - Intronic
1133271639 16:4613497-4613519 CCCCTGCAGTCCCCAGGAAGCGG + Intronic
1133320483 16:4910513-4910535 TTTCCACAGGGCCCAGGAAGAGG + Intronic
1133405078 16:5517287-5517309 TCCACACAGCCCCTGAGAAGGGG - Intergenic
1133734928 16:8607683-8607705 TCTCTCCAGCCCCCAGGCAGCGG - Intergenic
1134305026 16:13024246-13024268 TCCCTACAGCTGCCAGTAAGAGG - Intronic
1135142657 16:19934948-19934970 TCCCCACAACCCCCATGATCAGG - Intergenic
1136394327 16:29984804-29984826 ACCCCACAGCCCCTATGAGGAGG + Intronic
1136599718 16:31276925-31276947 TCCCCACAGTGCTCAGCAAGGGG - Exonic
1136610336 16:31362080-31362102 TCCCCACAGCCCCCAGAACGGGG - Exonic
1136617985 16:31410400-31410422 TCCCCACAGCCCCCAGGAAGAGG - Exonic
1137319626 16:47367366-47367388 TCCCCACAGCCTCCAGGAATGGG - Intronic
1137712114 16:50573634-50573656 TCCTCCTAGCCCTCAGGAAGCGG - Intronic
1138353690 16:56360910-56360932 TCCCGGACGCCCCCAGGAAGTGG + Intergenic
1138915215 16:61455478-61455500 ACCCCACTGCCCCCAGTAACAGG + Intergenic
1139354774 16:66361041-66361063 TGACCACAGCCCACAGGAGGTGG + Intergenic
1139615135 16:68084393-68084415 TCACCCCAGACCCCAGGAGGAGG + Intergenic
1141315909 16:82962290-82962312 TTCCCAGAGCCACCAGGAGGTGG + Intronic
1141552550 16:84815873-84815895 TCTCCACTGCCCCCAGAGAGTGG + Intergenic
1142194909 16:88734862-88734884 GCCCCCCAGCCACCTGGAAGAGG + Exonic
1142214214 16:88822837-88822859 CCCCCACGGCCCCCAGTTAGGGG - Intronic
1142233112 16:88909047-88909069 TGACCACAGGCCCCAGGCAGGGG + Intronic
1142317309 16:89355998-89356020 TCGCCTCAGCCCCCAGGGCGGGG - Intronic
1142610923 17:1108933-1108955 CCTTCACAGCCACCAGGAAGGGG + Intronic
1142836788 17:2593571-2593593 GCCCCAGACCCGCCAGGAAGAGG - Intronic
1143163679 17:4886969-4886991 CTCCCATTGCCCCCAGGAAGTGG + Intronic
1143258564 17:5582273-5582295 TCCAGACAGACCCCAAGAAGAGG - Intronic
1143503584 17:7352160-7352182 TCCTCTCCGCCCCCAGGAAGTGG - Exonic
1143729511 17:8873104-8873126 CCCCCACACACCCAAGGAAGGGG - Intergenic
1144697290 17:17313621-17313643 TCCCCGCAGCCCCTGGGATGAGG - Intronic
1144735717 17:17554237-17554259 TCCCCTCAGCCACAAGGCAGTGG + Intronic
1145262746 17:21364597-21364619 TCCCCAAAGCACCCAGGAGAGGG - Intergenic
1145262946 17:21365523-21365545 TCCCCAAAGCACCCAGGAGAGGG - Intergenic
1145786645 17:27598042-27598064 TCCCCACAGACACCAGGCAGTGG - Intronic
1145980385 17:29007638-29007660 TCCCCAGAGCCCACAAGAAGAGG - Intronic
1146359013 17:32159297-32159319 TCCCCAGAGCCACCATGATGGGG + Intronic
1146591871 17:34134336-34134358 GCCCCAAAGTCCCCAGAAAGGGG + Intronic
1147323271 17:39658558-39658580 TACCCACAGCCCCAAGAGAGGGG + Intronic
1147427675 17:40353889-40353911 TGCCTACAGCTCCCAGGATGAGG - Intronic
1147869593 17:43578147-43578169 GCCCCTCACCCCCCAGGCAGAGG + Intronic
1147979313 17:44264991-44265013 TCCCCACAGCCCCCAGTGCTCGG - Intronic
1147979335 17:44265050-44265072 TCCCCACAGCCCCCAGTGCTCGG - Intronic
1148215639 17:45832801-45832823 TCCTCACAGTCCCCTGGCAGTGG - Intronic
1148918127 17:51001816-51001838 TTCCCACAGCCCAGAGGAAACGG - Exonic
1148937236 17:51173282-51173304 TCCCTACAACCTCCAAGAAGAGG + Intergenic
1149567819 17:57652267-57652289 TCACCACAGCCCCGGGGAGGGGG + Intronic
1149621798 17:58050856-58050878 TCCCCACACCACCCCCGAAGAGG - Intergenic
1150467113 17:65403152-65403174 CCTCCACAGACCCCAGGGAGGGG + Intergenic
1151698068 17:75728102-75728124 TCCCCACAGCCTCGTGGCAGGGG - Intronic
1151796008 17:76346330-76346352 TCCTCTCGGCTCCCAGGAAGAGG + Intronic
1152255947 17:79239560-79239582 TGCCCACTGCCCCCAGGAGACGG + Intronic
1152309495 17:79540940-79540962 TCCCCCCAGGCCTCAAGAAGAGG - Intergenic
1152328561 17:79657115-79657137 CCCCCACTGCACCCTGGAAGAGG + Intergenic
1152570192 17:81118293-81118315 TGCCAACAGCCACCAGGACGTGG + Exonic
1152696921 17:81802275-81802297 TCCCTGCAGCCACCAGGAGGTGG + Intergenic
1152797990 17:82317311-82317333 ACAGCACAGCCCCCAGGAAGCGG - Intronic
1152809951 17:82376596-82376618 TCCCCAGGGCCTCCCGGAAGAGG + Intergenic
1152898736 17:82928201-82928223 TGCCCAGTGCCCCCAGGACGAGG + Intronic
1153700066 18:7683831-7683853 TCCCCAGAGCCTCCAGGTAAAGG - Intronic
1155046473 18:22107847-22107869 TCCCCACTGCCCACAGAAAAAGG - Intergenic
1155229480 18:23758556-23758578 TAGCCTCAGCCCCCAGGGAGAGG - Intronic
1156589402 18:38468994-38469016 TCCCCAGATACCCCAGGATGAGG + Intergenic
1157405465 18:47419076-47419098 TCCCAACAGCCCTCTGGAATTGG + Intergenic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1157712324 18:49858516-49858538 GCCCCCCACCCCCCAGGGAGGGG + Intronic
1157863245 18:51160227-51160249 TCCTCACACCCACCAGGATGTGG - Intergenic
1158454370 18:57593473-57593495 TCAGGACAGCCCCCAGGCAGAGG + Intergenic
1159444433 18:68523774-68523796 TCCCTACAGCCTCCAGAATGAGG + Intergenic
1160024070 18:75204634-75204656 TCCCCACCGCCACCACGGAGAGG + Intronic
1160823323 19:1068124-1068146 TCCCCACCCCCACCAGGAAGTGG + Intronic
1160861502 19:1238964-1238986 GCCCCACAGCACACAGGAACAGG - Intergenic
1161456823 19:4373780-4373802 TCCCCACGGCCCCCAGGCTGTGG + Intronic
1161468548 19:4445304-4445326 TCCCCACAGCCCCCAAGGGATGG + Exonic
1162479718 19:10921240-10921262 GGCCGAGAGCCCCCAGGAAGAGG - Intronic
1162767555 19:12929164-12929186 TCCCCACAAGCCCCGGAAAGAGG + Intronic
1162797023 19:13092351-13092373 TCCCCACAGGTCCCAGAAATGGG - Intronic
1162866669 19:13553177-13553199 ACCCTTCAGCCCCCAGGGAGTGG - Intronic
1163099939 19:15089304-15089326 TCCCCACAACCCCCAGTCAAGGG + Intergenic
1163291859 19:16384193-16384215 TCTCGGCAGCCCCCAGGCAGGGG - Intronic
1163322828 19:16584569-16584591 TCCCCACTGCTCCCAGGGTGTGG - Intronic
1164500410 19:28814961-28814983 TCCCCACTCCAACCAGGAAGTGG - Intergenic
1165064158 19:33219432-33219454 TCCCCACACACCACAGGAGGTGG - Intronic
1165068449 19:33241859-33241881 CCCCCACCGCCCCCGGGGAGGGG + Intergenic
1165364860 19:35359199-35359221 TGCTCACAGCTGCCAGGAAGAGG - Exonic
1165366679 19:35371668-35371690 TGCTCACAGCTGCCAGGAAGAGG - Exonic
1165381942 19:35488002-35488024 TCCCCACATCACAGAGGAAGCGG + Intronic
1166032123 19:40139711-40139733 TCCCCACAGTCCCCATCATGTGG + Intergenic
1166160716 19:40950892-40950914 CCCCCACAGCCCACAGAAAATGG + Intergenic
1166759915 19:45218005-45218027 TCCCCGCAGACCCCGGGCAGGGG + Intronic
1167247355 19:48381728-48381750 TCACCACAGTCCCCAGGACTTGG - Intergenic
1167289105 19:48614883-48614905 CCCCCACAGGCCCCTGGAGGAGG + Intergenic
1167534655 19:50041965-50041987 TCCCCCCAGCTCCCAGGACAAGG - Intronic
927040467 2:19225527-19225549 ATCCCACTGCCCCCAGGCAGAGG + Intergenic
927505297 2:23609449-23609471 TCCCCACAGCCCTCAGGATGTGG - Intronic
927964049 2:27258242-27258264 TGCCCACATCCGCCAGCAAGTGG + Exonic
928367432 2:30713643-30713665 ACCCTACAGACCCCAGCAAGAGG + Intergenic
929431448 2:41890793-41890815 CACCCACAGCCTCCAGGGAGGGG + Intergenic
929671300 2:43877984-43878006 TCCTCACTGTCCCCAGGAAGGGG - Exonic
929794391 2:45047824-45047846 TCCCACCAGCCCACAGGATGAGG - Intergenic
930088821 2:47517281-47517303 ACCCCAGAGTCCACAGGAAGAGG + Exonic
931203447 2:60123633-60123655 ACCCCACAGTCACCAGGGAGAGG - Intergenic
931267661 2:60674764-60674786 TTCCCACAGTCCCCAGGCATTGG + Intergenic
931757335 2:65385645-65385667 TACCCACTGCCACCAAGAAGTGG + Intronic
932618353 2:73250541-73250563 TCACCACACCACCCAGGAAAGGG - Intronic
933201032 2:79449104-79449126 TCCCCACTCCCCCCAAAAAGGGG + Intronic
933781466 2:85804746-85804768 TAGCCCCAGTCCCCAGGAAGTGG - Intergenic
934532653 2:95104658-95104680 TCCCCACAGCCACCAAGACACGG + Exonic
934553769 2:95277027-95277049 TGCCCACGGCCGCCAGCAAGGGG - Exonic
934706301 2:96484081-96484103 ATCCCACATCCCCCAGGAAAGGG + Intergenic
934708992 2:96503141-96503163 TCCCTACTCCCTCCAGGAAGTGG - Intronic
935259064 2:101339025-101339047 TTCCCTCAGCCCTGAGGAAGGGG + Intergenic
935620809 2:105128047-105128069 TCCTCACAGTTCCCAGGACGAGG + Intergenic
935636396 2:105252443-105252465 TCCCCAGAACCCCCTGCAAGGGG - Intergenic
936114679 2:109692282-109692304 TCCCCACCGCCCCCAGCCTGAGG - Intergenic
937025346 2:118692960-118692982 TCCCCTCAGCCTGCAGGGAGAGG + Intergenic
937273452 2:120669830-120669852 TCCCTACACGCCCCAGGAAAGGG - Intergenic
937757893 2:125562958-125562980 TCACAACAGCCCCCTGGAATAGG - Intergenic
937956090 2:127422543-127422565 CCCCCAAAGCCCGCAGGCAGAGG + Intronic
937993906 2:127679220-127679242 TCTACACAGACCCCAGGGAGGGG - Intronic
938135872 2:128755989-128756011 TCCCCACAGCCCACAGGATGGGG - Intergenic
938904543 2:135825823-135825845 CCCTCGCAGCCCACAGGAAGAGG + Intronic
941988765 2:171534295-171534317 TCCCCTAAGCCCACAAGAAGGGG - Intronic
943291577 2:186078845-186078867 TCCTCTCAGCTCCCAGTAAGAGG - Intergenic
944373201 2:199011005-199011027 TCCCCACAGACCCCACCAACAGG - Intergenic
945067567 2:205960049-205960071 TCCACACACCCCACAGGGAGAGG + Intergenic
946145002 2:217724049-217724071 ACCACACAGCCCCCAGCAAGGGG + Intronic
946229344 2:218282059-218282081 TGCCCATAGCCCCCAGGGGGCGG + Exonic
946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG + Intergenic
946888419 2:224247821-224247843 TCCCCCCTGCCCTCATGAAGAGG - Intergenic
947632952 2:231665621-231665643 TCCCCAAAGGCCCCAGGACTTGG + Intergenic
948099179 2:235359881-235359903 TCCCCACAGCCCTCTGGAAGGGG + Intergenic
948274507 2:236697794-236697816 TCCCCACAAACCCCGGGAGGTGG - Intergenic
948484337 2:238270993-238271015 TCCCCACTGCCCCCACGACCCGG + Intronic
948695255 2:239729927-239729949 TCCCCAAGGACCCCGGGAAGCGG - Intergenic
948738573 2:240026941-240026963 TTCTCTCAGCCCCGAGGAAGGGG + Intergenic
948861325 2:240754060-240754082 TCCTCCCAGCCCCCAGCATGAGG - Intronic
949000412 2:241610078-241610100 TCCCGAGGGCCCCGAGGAAGAGG + Intronic
1168953109 20:1815942-1815964 TCCCCACTACCCCTAGGAAATGG - Intergenic
1168956479 20:1837824-1837846 TCCCCACTGCAGCCACGAAGAGG - Intergenic
1168997964 20:2146724-2146746 TGGCTACAGCCCTCAGGAAGAGG - Exonic
1169142557 20:3234513-3234535 TCACCTCAGCCCCCAGGTAGAGG + Intronic
1169146290 20:3254715-3254737 TCCCCAAACCCCTCAGGAAAAGG + Intronic
1169480580 20:5976427-5976449 TTCTCTCAGCCCCGAGGAAGGGG + Intronic
1171376901 20:24699986-24700008 TTCCCCCACCCCCCAGCAAGGGG - Intergenic
1171484374 20:25476727-25476749 TCCCCACAGCCCGGACGCAGTGG + Exonic
1171891622 20:30723583-30723605 TCCCCGCAGCCCCTGGGATGGGG - Intronic
1172799252 20:37564686-37564708 CGCCCAGAGCCCCCAGGAAGGGG + Intergenic
1172843274 20:37914897-37914919 TCCTCAGAGCCCCCAGGCTGGGG + Intronic
1173136417 20:40443119-40443141 CCACCACAGCCTCCAGGAATGGG + Intergenic
1173329488 20:42062573-42062595 TCCCCAGAGGCCACAGGAGGGGG - Intergenic
1173644152 20:44623066-44623088 TCTTCACAGCCTCCTGGAAGGGG + Exonic
1174201586 20:48809898-48809920 TGCCCACAGGCCACAGGAAGTGG + Intronic
1174254175 20:49242067-49242089 TCCCCACTCCCCCTAGGCAGAGG + Exonic
1174390568 20:50216223-50216245 TCCCCACAGCCTCCAGGCTGGGG - Intergenic
1174804089 20:53592372-53592394 TCCCCCCACCCCCCAGAAAAGGG - Intronic
1174840311 20:53895166-53895188 TGCTCTCAGCCCCCATGAAGTGG - Intergenic
1175185986 20:57179889-57179911 TTTACACAGCCCCCAGGACGGGG - Intronic
1175234997 20:57503653-57503675 TCCCCACAGGCCCCTGAGAGGGG - Intronic
1175422025 20:58840658-58840680 GCCCCAGAGCCCCAGGGAAGGGG + Intronic
1175623093 20:60467345-60467367 TCCACTCAGCTCTCAGGAAGGGG - Intergenic
1176239047 20:64067507-64067529 ACCCCACTGTCTCCAGGAAGAGG - Intronic
1176625576 21:9088438-9088460 TCCCCACTGCCCCTGGGACGGGG + Intergenic
1179798389 21:43798907-43798929 TCCCCACCGCCCCCAGCACTTGG + Intronic
1179842645 21:44087335-44087357 TCCTCCCAGCCACGAGGAAGGGG + Intronic
1179878520 21:44283770-44283792 TCCCCACAGCCTCAAAGGAGAGG + Intergenic
1179903382 21:44406614-44406636 CCCACACAGCCAGCAGGAAGAGG - Exonic
1180214765 21:46317120-46317142 TCCCCACCTCCCCCTGGAGGTGG + Intronic
1180836847 22:18934233-18934255 TCCCCACAGCCCAGAGGGTGAGG + Intronic
1180938868 22:19643906-19643928 TCCCATCAGCCCCCAGGGTGGGG + Intergenic
1181004756 22:20007729-20007751 TCGCTACATCCCCCAGGAGGTGG - Intronic
1181179170 22:21055244-21055266 CCCCCACAGCCCCCACCCAGGGG + Intronic
1181577745 22:23806234-23806256 TTCCTACAGCCCTCAGGAAGAGG + Intronic
1181711936 22:24696522-24696544 TCCCCTCAGGTCCCGGGAAGGGG + Intergenic
1182266437 22:29119424-29119446 CCCCCACATCCTCCAGGGAGAGG - Intronic
1183303470 22:37069861-37069883 TCCCCACTGCCCTCAGGTAGAGG - Intronic
1183538743 22:38417678-38417700 TCCCCACTGCCTACAGGAAAAGG + Intergenic
1183708833 22:39490832-39490854 TGGCCACAGGCCCGAGGAAGAGG - Exonic
1183742969 22:39678607-39678629 CCCCCAGTGCCCCCAGCAAGGGG + Intronic
1184412144 22:44331620-44331642 TCCCCGCAGCCCCCAGAACCCGG - Intergenic
1184455929 22:44609423-44609445 TCCCCAGGGGCCCAAGGAAGGGG - Intergenic
1184777194 22:46629066-46629088 CCCTCACAGCCTCGAGGAAGGGG - Intronic
1184818543 22:46891046-46891068 TCCCGACAGCACTCAGGAAGGGG - Intronic
1184878655 22:47291304-47291326 TCCACACAGCCCCCTGGGATGGG + Intergenic
1184951233 22:47843830-47843852 TCTGCACGGCCCCCAGGAATAGG - Intergenic
1184986430 22:48139304-48139326 TCCCCTGAGACCCCAGGCAGAGG - Intergenic
1185041747 22:48507782-48507804 TCCCGACAGCTCCCAGGCAGGGG - Intronic
1185135686 22:49070788-49070810 GACCCACAGCCCCAGGGAAGTGG - Intergenic
1185211838 22:49574975-49574997 TCTCCCCAGACCACAGGAAGTGG + Intronic
1185340177 22:50287586-50287608 TCCCAACAGCTCCCAGCATGGGG + Intronic
1203286940 22_KI270734v1_random:159532-159554 TCCCCACAGCCCAGAGGGTGAGG + Intergenic
949581554 3:5393403-5393425 TCCACACAGTGCCCAGGATGTGG - Intergenic
951071797 3:18337638-18337660 TCCCCAGTGTCCCCAGGGAGTGG - Intronic
952160873 3:30691714-30691736 TCCCCACAGCTTACAGGGAGGGG - Exonic
953236180 3:41109675-41109697 TCCCAACAACCCCCAGGCATGGG + Intergenic
953749985 3:45601517-45601539 TCCTACCTGCCCCCAGGAAGGGG - Intronic
954333606 3:49903721-49903743 TCCCGACAGCCCCAAGATAGCGG + Intronic
954370802 3:50168733-50168755 CCCCCACAGGATCCAGGAAGGGG - Intronic
954868856 3:53751641-53751663 ACCCTACAGCTCCCGGGAAGGGG - Intronic
955705055 3:61719352-61719374 TCCCCACAACTCCCAGTTAGAGG - Intronic
956011349 3:64834831-64834853 TCTCCACAGCCTCCAGAAAGGGG + Intergenic
957120923 3:76091125-76091147 TCATCACAGCCACCATGAAGAGG + Intronic
957608695 3:82438916-82438938 TCCCCACAGTCACCAGAATGTGG + Intergenic
959210592 3:103374854-103374876 TCCCCAGAGCCTCCAAAAAGGGG - Intergenic
959368521 3:105493543-105493565 TCCTCACTGCGGCCAGGAAGTGG - Intronic
960664140 3:120094135-120094157 TCCCTTCAGACCCCAGGCAGCGG + Intronic
960993546 3:123326690-123326712 CCTCCACAGGCACCAGGAAGAGG - Intronic
961134115 3:124494350-124494372 TCCCCACATCCCCCCAGAAGTGG + Intronic
961357265 3:126346927-126346949 TCCTCACAGTCCTCAGGAATAGG - Intronic
961476109 3:127147366-127147388 CCCCCACACCCACCAAGAAGAGG - Intergenic
961497520 3:127305127-127305149 CCCCCACAGCAGCCAGGAACAGG - Intergenic
961695566 3:128701746-128701768 TGACCACAGCCATCAGGAAGTGG + Intergenic
961810556 3:129519327-129519349 CTCCCACACCCCACAGGAAGGGG - Intronic
961832978 3:129633924-129633946 CCACCACAGCCCCCAGGGCGGGG - Intergenic
962153783 3:132922201-132922223 TCCCAAAAGTACCCAGGAAGGGG + Intergenic
963593974 3:147301709-147301731 TCCCCCCGTCCCCCAGGCAGGGG - Intergenic
964383858 3:156126493-156126515 TCCCCATATCCCCAAGGAGGGGG + Intronic
965103674 3:164334076-164334098 TTCTCTCAGCCCCGAGGAAGGGG + Intergenic
966129705 3:176623644-176623666 TCTCCACAGTTCCCAGGAAAAGG + Intergenic
967479252 3:189955446-189955468 TGCCCATCGCACCCAGGAAGTGG + Intergenic
967873657 3:194251917-194251939 TCCCCACAGCACCCAGAACAAGG - Intergenic
968705302 4:2074840-2074862 TCCCCACAGCACCCAGCCACTGG - Intronic
968717095 4:2168321-2168343 TCACCAAGGCCTCCAGGAAGGGG + Intronic
968920748 4:3521178-3521200 TTCCCCCAGCCCCCAGGAAAGGG - Intronic
968986533 4:3878529-3878551 TCCCCACACTCCCCATGAACTGG - Intergenic
969512793 4:7629297-7629319 GCCACACAGCCTCCGGGAAGGGG + Intronic
969702336 4:8774325-8774347 CCCCCACACCCCCCAGCAAAGGG - Intergenic
970156921 4:13151225-13151247 TCCCCACTGCCCCCACCCAGAGG - Intergenic
972721667 4:41705606-41705628 TCCCCACAGGCCCCAGTATGTGG - Intergenic
974033839 4:56799977-56799999 TTCCCACAGCCATCAGGAAGAGG - Intergenic
974785741 4:66618480-66618502 ACTCCTCAGCCCCCAGGTAGTGG + Intergenic
978497696 4:109377748-109377770 TCCCCTCAGCCTGCAGGAGGTGG - Intergenic
978524905 4:109655405-109655427 TCTTCCCAGCCTCCAGGAAGGGG - Intronic
978754108 4:112285019-112285041 TTTCCGCAGCCACCAGGAAGTGG - Intronic
980148786 4:129021689-129021711 TCCCCATTGCCCTAAGGAAGGGG + Intronic
980291903 4:130855195-130855217 TAGCCACAGCCCACAGGCAGGGG - Intergenic
982612472 4:157593339-157593361 TACCCACAGCCCCAACCAAGTGG + Intergenic
984108039 4:175574790-175574812 ACACCACAGCCCCCCAGAAGTGG + Intergenic
984530466 4:180909624-180909646 TACCCACAGGTCCCTGGAAGAGG - Intergenic
984860176 4:184230696-184230718 TGCCCTTAGCCCCCAGGAGGAGG + Intergenic
984991777 4:185387940-185387962 TCCCCACTGTCCCGTGGAAGTGG + Intronic
985627759 5:998721-998743 GGCCCTCAGCTCCCAGGAAGAGG + Intergenic
985729495 5:1539412-1539434 TCCCCACAGTGCCCAAGATGGGG + Intergenic
985881681 5:2643073-2643095 TCTCCAGAGACCCCAGGCAGCGG - Intergenic
986332591 5:6728352-6728374 TCAGCACAGCCCCCTGGCAGCGG + Intronic
986799870 5:11247439-11247461 TCCCCACAGTCCCCACAAGGTGG - Intronic
990416327 5:55590628-55590650 TCCCCTCAGCCCCCATGCCGAGG - Intergenic
991145481 5:63297828-63297850 TCCCCACAGCCAACAAGAAATGG + Intergenic
993258569 5:85626841-85626863 ATCCCACATCTCCCAGGAAGGGG - Intergenic
993454918 5:88116608-88116630 TTCCCACAGCCTCCAGGTAGAGG - Intergenic
993544218 5:89191000-89191022 TCCCCAAACCCCCCAAGATGTGG - Intergenic
994968432 5:106703785-106703807 TCCCCTCCTCCCCCAGGAAGAGG - Intergenic
996776974 5:127143192-127143214 TCCCCACAGCCACCAGGACACGG + Intergenic
997210619 5:132074705-132074727 TGCCCCCAGCCCCCAGGAGTAGG - Intronic
997525706 5:134551977-134551999 GCCCCACAGGCCAGAGGAAGAGG - Intronic
998977824 5:147667812-147667834 TCCCCACAGCCTCCAGATACAGG - Intronic
999098845 5:149005575-149005597 GCCCCATAGCTCCCAGTAAGTGG - Intronic
999314443 5:150575035-150575057 TCCTCCCAGCCCCCCGTAAGGGG + Intergenic
999386522 5:151157617-151157639 TCCCTGCAGCCCCCGGGAAGGGG + Intronic
999452708 5:151690294-151690316 TCCCCACAGAGACCTGGAAGTGG - Intergenic
1000920213 5:167129160-167129182 TGCCCCCAGAACCCAGGAAGTGG + Intergenic
1001984565 5:176061939-176061961 TCCCCGCAGCCCCTGGGATGGGG + Exonic
1002063519 5:176640739-176640761 TCCCCACTGCCCCTAGGATCAGG + Intronic
1002232949 5:177782258-177782280 TCCCCGCAGCCCCTGGGATGGGG - Exonic
1002263042 5:178007561-178007583 TCCCCGCAGCCCCTGGGATGGGG + Intronic
1002543842 5:179925227-179925249 ACCCCCCAGCCTCCAGGGAGCGG + Intronic
1002634133 5:180598767-180598789 CCCCCACTGGGCCCAGGAAGGGG + Intergenic
1002659431 5:180781387-180781409 GCCCCAGAGACCCCAGGAGGTGG + Intergenic
1003041106 6:2687992-2688014 TCCCCACCCCCAGCAGGAAGCGG + Intronic
1003635453 6:7827637-7827659 TCACCAAAGGCCCCAGGAAGTGG + Intronic
1005483520 6:26277203-26277225 TCCCAACAGCTCCAAGGGAGTGG + Intergenic
1005685833 6:28252301-28252323 TTCCTAGAGCGCCCAGGAAGTGG - Intergenic
1005999786 6:30955862-30955884 AGCCCCCAGCCCCCAGGGAGGGG + Intergenic
1006135865 6:31896476-31896498 TCCCCTCTTCCCCCAGCAAGGGG - Exonic
1006186333 6:32183639-32183661 TCCCGACAGCCGGAAGGAAGAGG + Exonic
1006387403 6:33739007-33739029 TCCCCACAGCCTCCTGGCTGGGG + Intronic
1006454399 6:34123673-34123695 TCCTCACAGCACCTATGAAGTGG + Intronic
1006454463 6:34123898-34123920 TCCCCCCAGCCCCCAGCCTGAGG - Intronic
1007241782 6:40431841-40431863 TCCCAAAAGCCCCCCGGAACGGG - Exonic
1007812346 6:44495504-44495526 TCCCCACAGCCACCACCCAGGGG + Intergenic
1008621159 6:53272745-53272767 ACCCCTCAGCCCCCATGCAGTGG - Intronic
1011357022 6:86481546-86481568 TTCTCTCAGCCCCAAGGAAGGGG - Intergenic
1012474915 6:99607539-99607561 TGCCCTGAGCCCCCAGAAAGAGG - Intronic
1013048470 6:106510485-106510507 TCCGCAGCGCTCCCAGGAAGGGG - Intergenic
1016035261 6:139377073-139377095 TTCCCAAAGCACCCAGGAGGGGG - Intergenic
1017064821 6:150519059-150519081 TCCCCAGAGCCCACCGGAAGTGG + Intergenic
1017228564 6:152047832-152047854 TGGCCACAGGCCACAGGAAGAGG - Intronic
1017980591 6:159397961-159397983 TACACACAGCCCCCAGACAGAGG - Intergenic
1018092675 6:160358640-160358662 TCCCCAGAGCCACCCGGATGGGG - Intronic
1018284836 6:162226339-162226361 TATCCACAGCACCCAGGAAGGGG - Intronic
1018667890 6:166156264-166156286 TCCCCACAGCCCCCACAGTGGGG + Intergenic
1018743433 6:166747148-166747170 CACCCCCAACCCCCAGGAAGAGG - Intronic
1019179597 6:170177977-170177999 TGACCCCAGCACCCAGGAAGTGG + Intergenic
1019318825 7:405693-405715 CCCCCACACCCCCCATGGAGGGG + Intergenic
1019378954 7:711718-711740 TCCCCACAGACCCCCGGCAGGGG + Intronic
1019486927 7:1293642-1293664 TCCCCGCAGCCCCCAGGGTCCGG - Intergenic
1019505144 7:1386807-1386829 TGGCCACAGCACCCAGGCAGCGG + Intergenic
1019693618 7:2432257-2432279 TGCCCACAACTCCCAAGAAGAGG - Intronic
1020268438 7:6577505-6577527 TTCCCACAGCCCCGCGGAGGCGG - Exonic
1020461437 7:8433803-8433825 TCCCTACGCCCCCCGGGAAGGGG + Intergenic
1020980002 7:15054840-15054862 TTCTCTCAGCCCCGAGGAAGGGG - Intergenic
1023710289 7:42985561-42985583 TCACCAAATCCACCAGGAAGAGG - Intergenic
1023879536 7:44310342-44310364 TCCCTTCCGGCCCCAGGAAGTGG - Intronic
1024085005 7:45885361-45885383 GCCCCACTGCCCCCTGGCAGGGG - Intergenic
1024606175 7:51024387-51024409 TCCCCACACCCACTAGGAATGGG + Intronic
1024675613 7:51635655-51635677 CCCCAGCAGCCCACAGGAAGGGG - Intergenic
1024979425 7:55145083-55145105 TCCCCTAAGCCACCGGGAAGCGG + Intronic
1026878803 7:73895079-73895101 TCCCCACAACCCCCAGGGAGGGG + Intergenic
1027239875 7:76320142-76320164 TCCCCACCTCCCCCAGGCATAGG + Intergenic
1029226558 7:99033179-99033201 GCCACACAGCCCCCAGGAGCAGG + Intronic
1029491275 7:100871587-100871609 TCCCCATAGCCCGCAGGATCCGG - Exonic
1029536039 7:101158454-101158476 GCCCCACAGTGTCCAGGAAGCGG + Intronic
1029708740 7:102288240-102288262 TCCCCACTCCACGCAGGAAGAGG + Intronic
1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG + Intronic
1031531999 7:122886664-122886686 TCCCCAGAGCCCGCCGGCAGAGG + Intronic
1032079077 7:128849730-128849752 TCCCCACAGCACCCCCGAAGTGG + Intronic
1032441380 7:131945402-131945424 TCCTCAGAGCACCCCGGAAGCGG + Intergenic
1032854783 7:135825246-135825268 TCCCCAAGGCCCCCTGGATGTGG - Intergenic
1033624674 7:143097212-143097234 TCCCCCCACCCCCCACAAAGTGG + Intergenic
1033657377 7:143382530-143382552 TCCCCCCACCCCCAAGGCAGAGG - Intronic
1034318678 7:150159357-150159379 CCCCCACAGCTTCCAGGTAGAGG + Intergenic
1034736246 7:153431864-153431886 TTCTCTCAGCCCCGAGGAAGGGG - Intergenic
1034774078 7:153807855-153807877 CCCCCACAGCTTCCAGGTAGAGG - Intergenic
1034808078 7:154106068-154106090 TCTCCACAGCCCCCATGGAGAGG + Intronic
1035162269 7:156959859-156959881 TCACCACTGCCTCCAGAAAGTGG - Exonic
1035337630 7:158140222-158140244 TCCTCACCGCGTCCAGGAAGTGG + Intronic
1035599824 8:890960-890982 TCCTCACTGCCCCCAGGACCTGG + Intergenic
1036225682 8:6955672-6955694 TCCCTACTACCTCCAGGAAGGGG + Intergenic
1036416111 8:8550184-8550206 TCCCCACATCCTCCCTGAAGTGG - Intergenic
1038978724 8:32732111-32732133 CCCACACAGTCCCCAGGAGGAGG - Intronic
1039816632 8:41100416-41100438 TGCCCACACCCGCCAGCAAGAGG + Intergenic
1039821714 8:41140892-41140914 TGCACTCATCCCCCAGGAAGGGG + Intergenic
1041705999 8:60846895-60846917 TCACCACAGCCCCAAGGAGCAGG - Intronic
1043890003 8:85644126-85644148 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1043891543 8:85656040-85656062 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1043892615 8:85662877-85662899 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1043892942 8:85714458-85714480 GCATCTCAGCCCCCAGGAAGAGG + Intergenic
1043895629 8:85735912-85735934 GCATCTCAGCCCCCAGGAAGAGG + Intergenic
1043897050 8:85745896-85745918 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1043899376 8:85764264-85764286 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1043900984 8:85776457-85776479 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1043902948 8:85791732-85791754 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1043904558 8:85803925-85803947 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1043906170 8:85816116-85816138 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1043907778 8:85828306-85828328 GCATCTCAGCCCCCAGGAAGAGG - Intergenic
1044812587 8:96079392-96079414 TGACCACAGCCACCAGGAAGTGG - Intergenic
1044999522 8:97868290-97868312 TCACCCCAGCCTCCAGGAACTGG + Intergenic
1045239995 8:100391787-100391809 ACCCCACAGCACTCAGGAACTGG - Intronic
1045670133 8:104541669-104541691 TCCCCACATCCCCTAGCAACAGG + Intronic
1045944406 8:107779336-107779358 TCCAGCCTGCCCCCAGGAAGTGG - Intergenic
1047512928 8:125529317-125529339 AACCCAGAGTCCCCAGGAAGAGG - Intergenic
1048539590 8:135330719-135330741 TCCCCACAGCCCTTAGGCAGAGG + Intergenic
1048859144 8:138711026-138711048 TGTCCACAGCCCTCAGGATGAGG - Intronic
1049211127 8:141386933-141386955 GCCCCACAGGCCCCACGAGGGGG + Intergenic
1049257774 8:141623068-141623090 CACACACAGCCCCCAGGACGTGG - Intergenic
1049288401 8:141788888-141788910 TCTCCACAGGTCCCAGGATGAGG - Intergenic
1049322827 8:142006087-142006109 TTTCTGCAGCCCCCAGGAAGGGG - Intergenic
1049373460 8:142278452-142278474 TTCCAGCAGCTCCCAGGAAGGGG + Intronic
1049457271 8:142700170-142700192 ACCCCACGGCCCACAGAAAGTGG - Exonic
1049624063 8:143612288-143612310 TCCCCAGAGCCCTCAGGCTGAGG + Intergenic
1049800799 8:144516682-144516704 ACCCCAAAGCCCCCAGGTACAGG - Exonic
1050992884 9:12174510-12174532 TCACGACAGCACACAGGAAGGGG + Intergenic
1052999205 9:34568265-34568287 TGCCCACAGCCCACAGGACAAGG - Intronic
1053484631 9:38442558-38442580 TCCACACAGAGCCCTGGAAGGGG + Intergenic
1056332273 9:85530837-85530859 TCCCCAGAGCCCCCGGAAAGGGG - Intergenic
1056789170 9:89614709-89614731 TGCCCACAGTCCCCATGCAGGGG + Intergenic
1057182156 9:93036046-93036068 TGCCTGCAGCCCCCAGGAGGTGG + Exonic
1057199002 9:93130501-93130523 TCCTCACAGGCCCCTGGAAAGGG - Intronic
1057216116 9:93229876-93229898 CCGCCCCAGCCCTCAGGAAGCGG - Intronic
1057229210 9:93308712-93308734 TCCCCACAGCCCCAAGAACTAGG + Intronic
1057476995 9:95411480-95411502 TCACCCCAGCCCCAGGGAAGAGG - Intergenic
1057726564 9:97572440-97572462 TCCCCACAGCCCCCTGGTCCTGG - Intronic
1057836736 9:98451525-98451547 TCCCCACTGCCCCCCAGCAGTGG + Intronic
1058634176 9:107020310-107020332 TCCAAACAGCCCCCTGGAGGAGG - Intergenic
1058800781 9:108542817-108542839 TCCCCACTGCCACCTAGAAGAGG - Intergenic
1059422883 9:114203720-114203742 CCCCATCAGCCCCCAGGAAGTGG - Intronic
1059438060 9:114288399-114288421 TCCCCACATTCCCCAGGAGCAGG + Intronic
1060008916 9:120026323-120026345 TGCACACAACCCCCAAGAAGGGG + Intergenic
1060405913 9:123373053-123373075 TCCCCACTTCCCCCAGCGAGTGG - Intronic
1060779511 9:126401099-126401121 TCCCCACAGACCCCAGGCCATGG + Intronic
1060876113 9:127084644-127084666 TCCCCACTACCACAAGGAAGAGG - Intronic
1060930615 9:127487392-127487414 TCCCCAGCACCCCCCGGAAGTGG - Intronic
1060934164 9:127506150-127506172 TCCCAGCATCCCCCAGGATGGGG + Exonic
1061002468 9:127910166-127910188 CCCCCAGAGCCCCCCGCAAGAGG - Intronic
1061203181 9:129148695-129148717 TCCACACACCCTTCAGGAAGGGG + Exonic
1061296672 9:129680566-129680588 TCCCCAAGCCCCACAGGAAGGGG + Intronic
1061614948 9:131773418-131773440 TACCCACAGACCCCAAGAGGAGG - Intergenic
1061744234 9:132727974-132727996 TACTCACAGCTCCCAGGAAAAGG - Intronic
1061758163 9:132830033-132830055 TCCCCACAACCCCCAGCCACCGG - Intronic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1062310300 9:135931815-135931837 GCTCCACAGCCCGCAGGAGGCGG + Intergenic
1062315992 9:135967194-135967216 TCCCTGCAGCTCTCAGGAAGGGG + Intergenic
1062326922 9:136016960-136016982 TCCCAGCAGCTCCCAGCAAGGGG + Intronic
1062411705 9:136429107-136429129 GCCACACAGCCTCCAGGACGTGG - Exonic
1203748745 Un_GL000218v1:58899-58921 TCCCCACTGCCCCTGGGACGGGG + Intergenic
1185615465 X:1419172-1419194 TCCCCCCGACCCCCAGGGAGAGG - Intronic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1187683465 X:21792412-21792434 TCTCCACAGACACCAGGAGGTGG - Intergenic
1189363412 X:40370400-40370422 GCCCCACAGCCACCAAGGAGGGG - Intergenic
1192925048 X:75747317-75747339 TGCCCACAGACCAGAGGAAGGGG + Intergenic
1195272958 X:103251111-103251133 TCCGCACAGCCCCCAGAGGGTGG - Intergenic
1197715279 X:129701990-129702012 TCCCCACAGTTAGCAGGAAGCGG + Intergenic
1197787906 X:130218310-130218332 CCCCCTGATCCCCCAGGAAGAGG - Intronic
1199763058 X:150919993-150920015 TCCAAACAGCCCACAGGAAATGG - Intergenic
1200002168 X:153067656-153067678 TCCCCACAGCCCTCAGGATAAGG + Intergenic
1200005565 X:153082369-153082391 TCCCCACAGCCCTCAGGATAAGG - Intergenic
1200182492 X:154159293-154159315 TGCCCTCAGCACCCAGGAGGAGG + Intergenic
1200188146 X:154196407-154196429 TGCCCTCAGCACCCAGGAGGAGG + Intergenic
1200193796 X:154233547-154233569 TGCCCTCAGCACCCAGGAGGAGG + Intergenic
1200199551 X:154271351-154271373 TGCCCTCAGCACCCAGGAGGAGG + Exonic
1201162102 Y:11173868-11173890 TCCCCACTGCCCCTGGGATGGGG + Intergenic