ID: 1136625719

View in Genome Browser
Species Human (GRCh38)
Location 16:31461045-31461067
Sequence AAATAGTAGCTGAATGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136625719 Original CRISPR AAATAGTAGCTGAATGATGG GGG (reversed) Intronic
900836379 1:5007719-5007741 AAACAGTAGCTTAATCATGGTGG - Intergenic
901400771 1:9013920-9013942 TTAGAGTAACTGAATGATGGAGG - Intronic
901690165 1:10967673-10967695 AAATAGTTGTTGAATGAGGCTGG + Intronic
902666275 1:17941016-17941038 AAGTAGTAGCTGATTGATCCAGG + Intergenic
904193932 1:28770437-28770459 AAAAATTAGCTGGAGGATGGTGG + Intergenic
904207997 1:28867355-28867377 AAATATTAGCTGGGTTATGGTGG - Intergenic
905229810 1:36508013-36508035 AAACAGGAGCAGAATGATGTAGG - Intergenic
905467122 1:38163561-38163583 AATTAGTAGGTGAAGGATGCTGG - Intergenic
905613522 1:39376698-39376720 AAAAATTAGCTGAATTAGGGTGG - Intronic
906035078 1:42745703-42745725 AAATACAAGCTGTATGAAGGTGG + Intergenic
906178310 1:43795811-43795833 AAATAGTAGCAGACAGATAGGGG + Intronic
906192526 1:43907003-43907025 AGATAGGAGCTGACTGATGGAGG - Intronic
906265184 1:44423592-44423614 AAATATTTGCTGAATGAAGGAGG + Intronic
906919805 1:50051360-50051382 AAATATTAGCTGAATGTAAGGGG + Intronic
907776064 1:57516444-57516466 AAATGGCAGCTGACTTATGGGGG - Intronic
908986148 1:70024411-70024433 AAATAGCAGCTGCAAGATGTTGG - Intronic
910228556 1:84962648-84962670 AAATAGTACCTGAAAGGTGAGGG + Intronic
910810543 1:91231110-91231132 AAATAGTTTCTGAATTCTGGAGG - Intergenic
911762480 1:101632078-101632100 AAATAGCAGGTGAATAAGGGAGG - Intergenic
912470534 1:109903802-109903824 AAATATTTGCTGATTGATTGAGG - Intergenic
913082189 1:115399013-115399035 AAATACTTGTTGAATGAAGGAGG - Intergenic
914440569 1:147702197-147702219 AAAGAGAAGCTGGATGATGATGG + Intergenic
917190968 1:172418318-172418340 CAAAAGGAGATGAATGATGGGGG - Intronic
918831943 1:189409476-189409498 GAATAAAGGCTGAATGATGGAGG + Intergenic
1063916536 10:10888577-10888599 GAATAGTTGCTGAATGAGGCTGG - Intergenic
1064981204 10:21169158-21169180 TAATAATAGCTGAATGTCGGTGG + Intronic
1066240278 10:33526953-33526975 AAATAGTAGCAGACAGATTGGGG + Intergenic
1069078290 10:64061800-64061822 AAGAAGTAGCTGAAGAATGGGGG + Intergenic
1071681574 10:87711235-87711257 AGATAGTACCTGACTTATGGAGG + Intronic
1072534063 10:96346790-96346812 AAATAATACCTAAATAATGGGGG - Intronic
1078104015 11:8347186-8347208 AAATGGCAGCTGAATGCAGGGGG + Intergenic
1078737342 11:14032711-14032733 AAAAAGTAGATGAATGTTTGAGG - Intronic
1080754537 11:35183872-35183894 AAATAGTTGTTGAATAAAGGAGG - Intronic
1081360801 11:42175372-42175394 AAATATTTGCTGAATCATAGTGG + Intergenic
1081524192 11:43913360-43913382 AAATTATACCTGAATAATGGAGG - Intronic
1082219799 11:49620814-49620836 AAATATAAGCTGAATAATGTCGG - Intergenic
1082280482 11:50266499-50266521 AAATGTTAGCTGAATTCTGGTGG - Intergenic
1085749730 11:79150987-79151009 ACATAGTAGCTGAGTGATCCTGG - Intronic
1086630145 11:89007477-89007499 AAATAGCAGCAGAATGATAATGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087655501 11:100917926-100917948 AAAGAGAAGCTGAATGATGTGGG - Intronic
1088296488 11:108302002-108302024 AAATAGTAGTTGATTTTTGGGGG + Intronic
1088789298 11:113210457-113210479 AAATTGTATCTGAATTATGTGGG + Intronic
1092694849 12:11159936-11159958 ATATAGTAGCTGACTGAAAGTGG - Intronic
1092939178 12:13391362-13391384 AGATAGTGGCTGAATGTAGGAGG - Intergenic
1099350084 12:81556097-81556119 AAATAGTAGCCAAATGATCCAGG - Intronic
1099672519 12:85712616-85712638 AAATAGTGGCTGAGGGCTGGGGG - Intergenic
1100386266 12:94106823-94106845 ACATATTTGCTGAATGATGGTGG + Intergenic
1100877104 12:98974302-98974324 AAATTCTTGCTGAATGATTGGGG + Intronic
1100930523 12:99603639-99603661 AAATAGTTTCTGAATTCTGGAGG + Intronic
1101437773 12:104679057-104679079 AGACATTAGCTGAATGAAGGAGG + Intronic
1103056782 12:117827609-117827631 AAATAGTTGATCAATGATGTTGG + Intronic
1105341889 13:19534598-19534620 AACTAGTATATGAGTGATGGTGG - Intronic
1107318267 13:39158196-39158218 AAATAGTAGTTGAATGGGGAGGG + Intergenic
1107550007 13:41465214-41465236 AGAGGGCAGCTGAATGATGGGGG - Intronic
1109187593 13:59289092-59289114 ATATAGTATTTGAATGATAGGGG - Intergenic
1109233950 13:59792781-59792803 AAAAAGTAGGAGAATGAAGGAGG - Intronic
1109472290 13:62824768-62824790 AAATATTACCTGAATGATTTAGG + Intergenic
1110493728 13:76139976-76139998 AAAAAGTAGCTGGGTGTTGGTGG + Intergenic
1111329823 13:86750707-86750729 AAATAGTAGGGAAATAATGGAGG - Intergenic
1112219139 13:97470400-97470422 AAATAATAGCTGAATGAGCATGG - Intergenic
1112293869 13:98169209-98169231 AGATAGAAGCTGAAGGATGGGGG - Intronic
1112810846 13:103216842-103216864 AAATAGGAGGAGAATGATGAAGG - Intergenic
1112921858 13:104623194-104623216 AAATAGTAGATGGTAGATGGAGG - Intergenic
1114625767 14:24128986-24129008 AAAAAGTAGCTGGGTGGTGGCGG + Intronic
1114662217 14:24354267-24354289 AAATATTTGCTGAATGAGGGAGG - Intergenic
1117919411 14:60713532-60713554 AACAAGTAGCTTAATGATGCTGG - Exonic
1118419145 14:65580664-65580686 AAATGTTAGCAGAATTATGGGGG - Intronic
1120085626 14:80269405-80269427 AAAGAGGAGGTGAATGAAGGAGG + Intronic
1126137486 15:45405657-45405679 AAATAGTATATGATTGAGGGTGG + Intronic
1127746314 15:61979156-61979178 AAATTGGAGCTGAATTATAGTGG - Intronic
1128614370 15:69097837-69097859 AAATATTTGCTGAATGAATGAGG + Intergenic
1131031411 15:89189012-89189034 AAAGAGTAGATGAATGAAGTGGG - Intronic
1134357930 16:13501704-13501726 AAATATTTGCTGAAAGAGGGCGG + Intergenic
1134860861 16:17559146-17559168 AAAAAGAAGTTGAATGAAGGTGG + Intergenic
1135107456 16:19662662-19662684 AAATAGTAAGTGAATGTGGGGGG - Intronic
1136625719 16:31461045-31461067 AAATAGTAGCTGAATGATGGGGG - Intronic
1137556244 16:49472231-49472253 AAATATTTGTTGAATGATGTGGG - Intergenic
1139322140 16:66123384-66123406 TAATAGTAGCTAAATTTTGGGGG - Intergenic
1140154607 16:72410701-72410723 AAAGTGTACATGAATGATGGGGG - Intergenic
1140662610 16:77201952-77201974 AAAAAGTATCTGAATGATAAAGG + Exonic
1143986726 17:10920974-10920996 GAATAGTAGCCTATTGATGGAGG + Intergenic
1144743618 17:17598370-17598392 GAATATTTGCTGAATGAAGGAGG + Intergenic
1147028699 17:37611806-37611828 AAAAATTAGCTGAGTGTTGGTGG + Exonic
1148591410 17:48818944-48818966 AAACTGAAGCAGAATGATGGAGG + Intergenic
1149061910 17:52432761-52432783 AAATAGTAATGCAATGATGGAGG - Intergenic
1150497389 17:65618430-65618452 AAATATGAGCTCAATGATGTCGG + Intronic
1154959753 18:21296629-21296651 AAAGAAAAGCTGAATGATTGGGG - Intronic
1155683349 18:28517048-28517070 AGAAAGTAACTGAATCATGGAGG + Intergenic
1157882917 18:51338981-51339003 AAATAGTGGCTGAATGAATTTGG + Intergenic
1159302141 18:66587687-66587709 AATCAGTAGTTGAAGGATGGTGG + Intronic
1161195882 19:2986418-2986440 AAAAAGTAGATGAAGGCTGGGGG + Intronic
1163053128 19:14699990-14700012 AAAAAAGAGGTGAATGATGGTGG - Intronic
1168500111 19:56885809-56885831 AAAAAATAGCTCAATGATGATGG + Intergenic
925726191 2:6874804-6874826 AAATAGTGTCTGAATTTTGGAGG - Intronic
926618123 2:15020048-15020070 AAATAGTAGCTGTATGAACTTGG - Intergenic
926997390 2:18751191-18751213 CAAGAGAAGCTGAATGATGGGGG - Intergenic
929253254 2:39781524-39781546 AAAGAGTACCTGAGTAATGGGGG - Intergenic
930173613 2:48278054-48278076 GAATAGTAGCTGAAATTTGGAGG - Intergenic
933431416 2:82184824-82184846 AAATAGAAAATGAATGATGAAGG + Intergenic
933522335 2:83389626-83389648 AAATAGTAGCTAAGGAATGGTGG + Intergenic
935371555 2:102352119-102352141 AAATGGTGGCTGGAGGATGGTGG - Intronic
938170679 2:129073067-129073089 AAATAGTACCTGATTAATTGTGG + Intergenic
938884573 2:135630534-135630556 AAATATTTAATGAATGATGGGGG + Intronic
939111505 2:138013340-138013362 AAATTGGAGCTGAATGAGTGAGG - Intronic
939724683 2:145702588-145702610 AAATAGTAACTTTATAATGGAGG - Intergenic
939762072 2:146194897-146194919 AAGTAGTAGCTTAATGAGTGTGG + Intergenic
941695152 2:168543371-168543393 AGATAGAAGCAGATTGATGGGGG - Intronic
942876333 2:180804322-180804344 AAACATTAGCTGAACCATGGTGG - Intergenic
942900647 2:181113392-181113414 CAAAAGTAGCTGCAAGATGGTGG + Intergenic
943210197 2:184954257-184954279 AAATATTAGTTGAATAATAGTGG + Intergenic
943559633 2:189445220-189445242 ATGTATTAGCTGAATGATGTTGG - Intronic
944106159 2:196081961-196081983 AAATAGAAGCTGGATTATAGAGG - Intergenic
944928569 2:204491935-204491957 AAATCCTAGCAAAATGATGGTGG - Intergenic
945982759 2:216327356-216327378 AAATAGAATCTGTATGCTGGTGG - Intronic
946159760 2:217828905-217828927 AAATCGTGGCTGTAAGATGGGGG + Intronic
948179407 2:235967562-235967584 AAATACCAGCTGAATGAGTGCGG + Intronic
1169650564 20:7862165-7862187 CAATAGTATCAGAATGATGATGG + Intergenic
1170378911 20:15734525-15734547 AAATAGTAGAAGCATTATGGAGG + Intronic
1171033277 20:21695545-21695567 CAATAGAAGATGAGTGATGGAGG - Intergenic
1174246619 20:49187196-49187218 AAGAAGAAGCTGGATGATGGCGG + Intronic
1177060772 21:16371689-16371711 ATATACTAGCTGAATGATCATGG + Intergenic
1177335907 21:19726870-19726892 AAATAGTAGCGGTAAGATGAAGG + Intergenic
1178662375 21:34518665-34518687 AAATAGGAGCTGCATGAGGGAGG - Intronic
1178753854 21:35329005-35329027 ACATATTAGTTGAATGAAGGAGG - Intronic
1179146213 21:38770030-38770052 AAATAGGAGCTGAATAATTAGGG - Intergenic
1179185740 21:39084079-39084101 CAACAGCAGCTGAATGTTGGTGG + Intergenic
1183825956 22:40387757-40387779 AAATATTAGAGGAATGATCGAGG + Intronic
949978033 3:9478388-9478410 AAATAGTTGCTGAATGAATGAGG - Intronic
950356790 3:12417593-12417615 AAGTAGTATCTTACTGATGGTGG - Intronic
955547703 3:60048819-60048841 AAACAGCAACTGAATGATGCTGG - Intronic
956198967 3:66685105-66685127 AAATAGTAGCAGATGGATTGAGG - Intergenic
957118274 3:76055554-76055576 AAGTAGGAGCTAAATAATGGGGG - Intronic
957326261 3:78699180-78699202 AAATAGTAGGTGAATGCTGTTGG - Intronic
957868707 3:86059778-86059800 AAGTATTACCTGAATGATGCAGG - Intronic
959946663 3:112132707-112132729 AAATAGTGGCTGAAAGAGGGTGG + Intronic
963275360 3:143324526-143324548 AAATAGTAGCTGCTGGCTGGGGG + Intronic
963352876 3:144174344-144174366 TAATTATAGCTGGATGATGGGGG - Intergenic
965169557 3:165244443-165244465 GAATAGTTGCTGAATTTTGGAGG + Intergenic
967246267 3:187490421-187490443 AAATAAAAGCTGGAAGATGGTGG + Intergenic
967348022 3:188480333-188480355 GAATATTAGCTGAATGATTTGGG + Intronic
968441080 4:624912-624934 AAAAAGGACCTGAATGTTGGGGG - Intergenic
970587809 4:17531175-17531197 AAATAGTAGCTTCAGGAAGGGGG + Intergenic
971065596 4:23028580-23028602 AAATACTAGCTGACTTACGGTGG - Intergenic
971862447 4:32125444-32125466 AAATTGTAACAGAAGGATGGGGG + Intergenic
972201530 4:36719001-36719023 ATTTTGTAGCTGAATGATTGTGG + Intergenic
975425601 4:74223399-74223421 AAGTAGGAGCTAAATGATGAGGG + Intronic
975775688 4:77784634-77784656 AAAGATTAGCTGGATGGTGGTGG - Intronic
979147262 4:117260208-117260230 AAATAGTATCTGAATTTTGAAGG - Intergenic
979199874 4:117964523-117964545 AAATGGAAGCTGAAGGATGAGGG - Intergenic
979492021 4:121339064-121339086 AAATAATAGCTGAATCATTAGGG - Intronic
979713484 4:123808865-123808887 ACATAGTCACTGAATGAGGGAGG + Intergenic
983872771 4:172841408-172841430 AAATAGTAGCTGCATGAACTTGG - Intronic
984595616 4:181664096-181664118 ACATACTAGCTGAATGATCCAGG + Intergenic
986170812 5:5313143-5313165 ACATAGCAGATGAATCATGGTGG - Intronic
986908168 5:12520373-12520395 AGAAAGTAACTGAATCATGGGGG - Intergenic
988194908 5:27992834-27992856 AAAAAGTACCTGTAGGATGGGGG - Intergenic
990726337 5:58759066-58759088 AAATATTTGTTGAATGTTGGAGG - Intronic
990817095 5:59797938-59797960 AAATAGGAGCAGAAGGCTGGGGG + Intronic
992783554 5:80149363-80149385 AAAGAGTTGGTGAATGATGTTGG + Intronic
993874607 5:93292013-93292035 AAATGGTAGGGGAATGAGGGTGG - Intergenic
995476205 5:112551036-112551058 AAAAAGTGGCTGGATGAGGGTGG - Intergenic
995949120 5:117688425-117688447 AAATATTAGCTGAACGTGGGTGG - Intergenic
1001052064 5:168421599-168421621 AAATATGAGCTGAAAGATGGAGG + Intronic
1003199829 6:3949147-3949169 AAAAACAAGCTGAATGATGACGG + Intergenic
1003258841 6:4497750-4497772 AAATAACAGCTGAATGAAGTGGG + Intergenic
1004126831 6:12882206-12882228 AGATAGTAGCTTAAGGAAGGAGG + Intronic
1006612684 6:35303978-35304000 AAAAATTAGCTGGATGTTGGTGG + Intronic
1007493457 6:42242750-42242772 AATTAGTTCCTTAATGATGGAGG + Intronic
1009049402 6:58259870-58259892 AAATAGTATCTCAATGGGGGTGG + Intergenic
1011405500 6:87011421-87011443 AAATATTCTCTAAATGATGGTGG + Intronic
1012074522 6:94668182-94668204 GAAAGGTAGCTGAATCATGGGGG + Intergenic
1012739617 6:102999755-102999777 TAATAGTAGCTAAGTGATGGAGG - Intergenic
1014834793 6:126148546-126148568 ACATATTAGCTGAATGATCTGGG + Intergenic
1015022012 6:128487656-128487678 TAATAGTAACAGAGTGATGGGGG + Intronic
1015237521 6:130987961-130987983 AAAAATTAGCTGAGTGTTGGTGG + Intronic
1015240357 6:131015716-131015738 AAATATTAGTTGAATGTAGGTGG - Intronic
1015845534 6:137516485-137516507 AAGAAGTAGCTGGATGATTGAGG - Intergenic
1018504999 6:164456501-164456523 AAATAGCAGCTGAATGAATGAGG - Intergenic
1018764923 6:166925547-166925569 AGACAGTGGCTGCATGATGGAGG - Intronic
1020496235 7:8856284-8856306 GAATAATAGGTGAATGATGGAGG + Intergenic
1023767883 7:43528992-43529014 AAACAGTATCTGAATAAAGGTGG + Intronic
1024776968 7:52799004-52799026 AAACAGCAGCTGAATTATGGAGG - Intergenic
1027424142 7:78045584-78045606 AAAAAGAAGCTGAATAATGATGG + Intronic
1027943565 7:84716615-84716637 TCATAGTAGCTGAATGGTGTAGG - Intergenic
1028385506 7:90248787-90248809 AAATAGTACCAGAATTTTGGTGG + Intronic
1028678997 7:93503704-93503726 AAATAGTAGGGGAAAGAGGGAGG + Intronic
1028861916 7:95662049-95662071 AAAAGGGAGCTCAATGATGGAGG + Intergenic
1031076791 7:117220920-117220942 GAATAGGAGCTGAATGGTAGAGG + Intronic
1031942330 7:127802161-127802183 AATTAGTAGTTGAATTTTGGGGG - Intronic
1032423751 7:131803654-131803676 AAATAGTAGAGGAAGGATGGAGG + Intergenic
1033159460 7:138982719-138982741 ACATAGGGGCTGTATGATGGGGG - Intergenic
1033163137 7:139015074-139015096 AAATATTAGCTGAATTTTAGAGG - Intergenic
1036011019 8:4723819-4723841 AAACAGTGCCTGAATCATGGAGG + Intronic
1037061208 8:14511959-14511981 AAATAATAGCTGAACTCTGGAGG + Intronic
1037629558 8:20641596-20641618 AAATATTTGCTGAGTGTTGGTGG + Intergenic
1039641186 8:39225099-39225121 AAATAGTAGCTGATTCTTGGAGG - Intronic
1040576399 8:48655210-48655232 AATTAGTAGCAGAGTGAAGGAGG + Intergenic
1041111400 8:54486327-54486349 AAATAGGATCTAAATGTTGGAGG - Intergenic
1041591242 8:59587078-59587100 AAATAGTGCCTGACTGATGGGGG + Intergenic
1043298139 8:78692704-78692726 AATTAGAAGCTCAATGTTGGAGG - Intronic
1043325066 8:79039952-79039974 GAAGAGTAGCTGATTGATGCTGG + Intergenic
1044579060 8:93804465-93804487 AAAAAATAGCTGAGTGTTGGTGG - Intronic
1044599517 8:93989963-93989985 AAATAGCCGCTGACTTATGGTGG - Intergenic
1044898272 8:96916238-96916260 AAATAGGAACTGGAAGATGGAGG - Intronic
1046333516 8:112753196-112753218 AAATAGTATATGAGTTATGGTGG + Intronic
1046691321 8:117288286-117288308 AATTATTTGCTGACTGATGGAGG + Intergenic
1047393467 8:124473606-124473628 AAGCAGTAGATAAATGATGGCGG + Intergenic
1048196569 8:132336431-132336453 AGAAAGTACCTGCATGATGGGGG + Intronic
1048560475 8:135530810-135530832 GAATGGTATCTGAAGGATGGAGG - Intronic
1049045258 8:140145544-140145566 ATATAGTAGCAGATTGATTGAGG - Intronic
1052141840 9:24995183-24995205 AAATAATTTCTGAAAGATGGAGG + Intergenic
1053373981 9:37589104-37589126 CAATAATAGCTGAATGACAGTGG - Intronic
1055142304 9:72889447-72889469 AAATAATATCTGAATGGTGATGG - Intergenic
1055747754 9:79469058-79469080 AAATATTTGCTGGATAATGGTGG - Intergenic
1055984330 9:82040831-82040853 TAATGGTAGCTTAAGGATGGTGG - Intergenic
1055998720 9:82191529-82191551 AAACAGTATTTGAATGATGTGGG + Intergenic
1058100376 9:100912998-100913020 AAATGGTAGCTGGGTGAGGGAGG + Intergenic
1058413459 9:104760860-104760882 AAGTATTAGCTGAAGGATGGTGG - Intergenic
1060534965 9:124378402-124378424 AAGTAGCAGCTGAATGCTGCTGG - Intronic
1061686094 9:132280066-132280088 AAACAGTGCCTGAATTATGGTGG + Intronic
1186128843 X:6444767-6444789 AAATAGTAGCTGAACACTGGGGG - Intergenic
1186562331 X:10625955-10625977 AAATTGTAGCAGGAGGATGGAGG + Intronic
1187491350 X:19754618-19754640 AAAAATTAGCTGGATGTTGGTGG - Intronic
1188187938 X:27139091-27139113 AAATAATAACTGAGTGAAGGTGG - Intergenic
1189984076 X:46538249-46538271 AAGTGGTTACTGAATGATGGTGG - Intronic
1190415210 X:50174119-50174141 AAAAAGAAGCTGAATGAGGCTGG + Intergenic
1192084186 X:68079178-68079200 AGAAAGGAGATGAATGATGGAGG - Intronic
1192267658 X:69550220-69550242 AAATAGTAGCATAATCATGGGGG - Intergenic
1192421801 X:71039101-71039123 CAATAGTGGGTGGATGATGGAGG + Intergenic
1193677007 X:84467011-84467033 AAAGAGTAGGTGAATGAAGGAGG + Intronic
1193729497 X:85086015-85086037 AAATAGTATCTGCTTCATGGTGG + Intronic
1194063510 X:89234362-89234384 AAATAGTAACAGATTGTTGGAGG - Intergenic
1194885145 X:99305602-99305624 AACTAGTAGATGAATGAGGTAGG + Intergenic
1195503078 X:105625724-105625746 AAATAGTAGTTTATTGTTGGGGG - Intronic
1196832851 X:119789879-119789901 AAATACAAGCAGTATGATGGAGG + Intronic
1197834950 X:130684612-130684634 AAATATTTGTTGAATGATGGTGG - Intronic
1199009634 X:142743815-142743837 GAATATTAGCTTATTGATGGTGG - Intergenic
1199705103 X:150417924-150417946 GAGTAGTATCTGAATGATGCTGG + Intronic
1200717685 Y:6568468-6568490 AAATAGTAACAGATTGTTGGAGG - Intergenic
1201611202 Y:15844960-15844982 AAATAGTAGCTGAACACTAGGGG - Intergenic