ID: 1136627675

View in Genome Browser
Species Human (GRCh38)
Location 16:31472072-31472094
Sequence CCGTGACCATGTAAGGAAGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136627675_1136627686 23 Left 1136627675 16:31472072-31472094 CCGGCTTCCTTACATGGTCACGG 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1136627686 16:31472118-31472140 CCCCCGCCCCCCGCCCCCACCGG 0: 2
1: 1
2: 30
3: 272
4: 1692
1136627675_1136627680 -4 Left 1136627675 16:31472072-31472094 CCGGCTTCCTTACATGGTCACGG 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1136627680 16:31472091-31472113 ACGGCCGGGCTTCCAGCTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 178
1136627675_1136627691 29 Left 1136627675 16:31472072-31472094 CCGGCTTCCTTACATGGTCACGG 0: 1
1: 0
2: 0
3: 11
4: 84
Right 1136627691 16:31472124-31472146 CCCCCCGCCCCCACCGGACACGG 0: 1
1: 0
2: 2
3: 38
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136627675 Original CRISPR CCGTGACCATGTAAGGAAGC CGG (reversed) Exonic
900459459 1:2795479-2795501 CCAGGGCCATGTAAGGAAGCTGG - Intronic
903654621 1:24941779-24941801 CCATGACCCTGTAAGGAGGCGGG - Intronic
913290868 1:117270344-117270366 CAGTGAGCATGTTAGGATGCAGG + Intergenic
913317267 1:117563787-117563809 TCTAGACCAGGTAAGGAAGCTGG + Intergenic
914858164 1:151366903-151366925 CCCTGAACAGGGAAGGAAGCAGG + Exonic
920652932 1:207852242-207852264 CCATGACCATCTCAGGAAGTGGG + Intergenic
923697267 1:236265684-236265706 TATTGACCATGTAAGGATGCTGG - Intronic
1065795535 10:29304060-29304082 CCGTGACCATTTTCTGAAGCTGG + Intronic
1071709211 10:88032524-88032546 CCGTCAAGATCTAAGGAAGCTGG - Intergenic
1076769268 10:132654243-132654265 CCGTGCCCAGGCAGGGAAGCCGG - Intronic
1080381975 11:31781393-31781415 CAGTGTCCACGTGAGGAAGCAGG - Intronic
1080582534 11:33656026-33656048 CCATGACCATCTCAGGAAGCTGG - Exonic
1084512765 11:69616422-69616444 GCGTGACCAGGTGGGGAAGCAGG - Intergenic
1085575857 11:77601858-77601880 CCCTGACCATGTAAGTTTGCTGG - Intronic
1085829884 11:79888198-79888220 CAGTGACCAGGTAGGGAAGATGG + Intergenic
1097068709 12:56339267-56339289 CCGTGACCTTGAGTGGAAGCTGG + Intronic
1101822844 12:108197238-108197260 CTGCTACCATGGAAGGAAGCAGG + Intronic
1102498289 12:113334430-113334452 CCGTGGACAGGTAAGGAACCTGG - Exonic
1102741423 12:115210904-115210926 CTGTGACCATGTCAGAAACCAGG + Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103290206 12:119839418-119839440 CCGTGAAAATGTAATGACGCTGG + Intronic
1107072356 13:36285084-36285106 CCGTTACCATGTTAGGAAAGGGG - Intronic
1107720968 13:43247444-43247466 CCTTGACCATGGAAGGCTGCTGG - Intronic
1113809226 13:113127957-113127979 GCGTGAGCATGTGAGGAGGCTGG + Intronic
1118039812 14:61904354-61904376 CCGAGGCCCTGAAAGGAAGCTGG - Intergenic
1118325603 14:64778482-64778504 CCTGAATCATGTAAGGAAGCTGG - Intronic
1118738660 14:68722008-68722030 CAGTCCCCATGTAAGCAAGCAGG + Intronic
1123725031 15:23093197-23093219 CCTACACCAGGTAAGGAAGCTGG + Intergenic
1126017432 15:44365926-44365948 CCATGGCCATGTATGGGAGCAGG + Intronic
1126975107 15:54169119-54169141 CAGAGACCATCAAAGGAAGCAGG + Intronic
1128010733 15:64293652-64293674 CCGTGGCCCTGTTAGGAACCAGG + Intronic
1128826020 15:70718212-70718234 CTCTCACCTTGTAAGGAAGCAGG - Intronic
1128998399 15:72313603-72313625 ACGTGAGCATGGAGGGAAGCTGG - Intronic
1132371418 15:101302027-101302049 CCGGGCCCAGGGAAGGAAGCTGG - Intronic
1135662780 16:24311008-24311030 CCGTTTCCATGTTGGGAAGCAGG + Intronic
1136627675 16:31472072-31472094 CCGTGACCATGTAAGGAAGCCGG - Exonic
1136641003 16:31565017-31565039 CCGTCACCATGTTAAGAAGCAGG + Intergenic
1140887952 16:79261089-79261111 CCGGGAGCAGGTGAGGAAGCTGG + Intergenic
1143135590 17:4710735-4710757 CCGGGACCAGGTAAGGGAGGTGG + Exonic
1145266209 17:21380732-21380754 CCTTGGACATGTAGGGAAGCAGG + Intronic
1155239261 18:23849271-23849293 CTGGAACCTTGTAAGGAAGCTGG + Intronic
1157966949 18:52218962-52218984 GAGTGACCATGCAGGGAAGCTGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1161872703 19:6882628-6882650 CCTTGAGCATGTAGGGATGCTGG - Intergenic
925602006 2:5617647-5617669 CAGTGACCTTGTTAGGCAGCTGG + Intergenic
931755209 2:65367781-65367803 CCAAAACCTTGTAAGGAAGCTGG - Intronic
931772775 2:65512997-65513019 CTGTGACCATGCAAGAAAGAAGG + Intergenic
933053377 2:77630216-77630238 AAGTGACCATGTAAGGGAGCAGG + Intergenic
936671402 2:114661519-114661541 CCGTGTCCCTGTAAGGATTCAGG + Intronic
942685609 2:178528235-178528257 CCTTAAACATGTAAGGAAGAAGG + Intronic
1169532263 20:6498393-6498415 CAGTGACCAGGTAGAGAAGCCGG + Intergenic
1170437844 20:16349080-16349102 CCTTCTCCATGAAAGGAAGCAGG - Intronic
1172128536 20:32639960-32639982 TCGTGAGAATGAAAGGAAGCAGG - Intergenic
1173877656 20:46385245-46385267 CCTACACCATGTAAGGAAGCTGG - Intronic
1175467350 20:59198370-59198392 CTGTTGCCATGTAAGGAGGCAGG - Intronic
1175597991 20:60250701-60250723 CAGTGAGCAGGCAAGGAAGCAGG + Intergenic
1179145031 21:38760626-38760648 ACATGACCATGTAAGGACACAGG + Intergenic
1182246599 22:28963173-28963195 TCAAGACCATGTAATGAAGCAGG + Intronic
950216307 3:11162222-11162244 CAGTCACCATGCAAGGAACCAGG + Intronic
950414224 3:12859363-12859385 CCGTGACCATGTAGGGGTACAGG - Intronic
950750663 3:15125438-15125460 CCGTGACCAGGTGAAGAGGCAGG - Intergenic
951155525 3:19348713-19348735 CCATGACCAAGGAAAGAAGCAGG - Intronic
961110462 3:124279087-124279109 CTCTGACCAAGGAAGGAAGCAGG - Intronic
961283307 3:125780193-125780215 CCGTGACCAGGTGAAGAGGCAGG - Intergenic
965521288 3:169669954-169669976 CCGTGACCACGGCAGAAAGCAGG - Intergenic
969014396 4:4094040-4094062 CCGTGACCAGGTGAAGAGGCAGG + Intergenic
969739567 4:9014381-9014403 CCGTGACCAGGTGAAGAGGCAGG - Intergenic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
972897109 4:43637090-43637112 CAGTCACCATGAAAGGATGCAGG - Intergenic
984540796 4:181034682-181034704 CAGAGACAAGGTAAGGAAGCAGG - Intergenic
992070437 5:73143913-73143935 CCGTCTGCATGTAAGGCAGCTGG - Intergenic
998403405 5:141860043-141860065 CGGTGACCCTGTGAGGAGGCAGG + Intronic
1004263985 6:14133139-14133161 CAGGGACTATGAAAGGAAGCAGG - Intronic
1005406894 6:25498983-25499005 CCCTGACCTTGTTAGGAGGCTGG - Intronic
1006186468 6:32184223-32184245 CCAGGACCCTGGAAGGAAGCAGG - Exonic
1012412651 6:98976326-98976348 CCATGCACATGGAAGGAAGCAGG + Intergenic
1014763129 6:125380065-125380087 CCTTGACCATTTAAGAAAGTTGG + Intergenic
1018638422 6:165885052-165885074 CGTAGACCAAGTAAGGAAGCCGG + Intronic
1022467174 7:30659823-30659845 CTGTGGCCCTTTAAGGAAGCTGG + Intronic
1029073069 7:97915677-97915699 CCGTGACCAGGTGAAGAGGCAGG + Intergenic
1034065168 7:148129216-148129238 CCGTGACTATGTAAATAAGCTGG - Intronic
1034949830 7:155289831-155289853 CCTTCACCATGTGAGGATGCAGG - Intergenic
1036256119 8:7208124-7208146 CCGTGACCAGGTGAAGAAGCAGG + Intergenic
1036361365 8:8079375-8079397 CCGTGACCAGGTGAAGAAGCAGG - Intergenic
1036889609 8:12587648-12587670 CCGTGACCAGGTGAAGAAGCAGG + Intergenic
1038922415 8:32099437-32099459 TGGTGACCATCTAAGGAAGTTGG + Intronic
1052545518 9:29872938-29872960 TACTGACCATGTAAGGAAGCAGG - Intergenic
1060066250 9:120503817-120503839 CCATGGCCATGTGAGGAAACCGG - Intronic
1188980367 X:36721684-36721706 CTGTGACCCTGTAAGGACCCGGG + Intergenic
1190797886 X:53760865-53760887 AAGGGACCATGTAAGGGAGCTGG + Intergenic
1190917272 X:54820345-54820367 AAGGGACCATGTAAGGGAGCTGG - Intergenic
1193970935 X:88051790-88051812 CCGTGATAATATAAAGAAGCAGG + Intergenic
1198391540 X:136180216-136180238 ATGTGACCATATAACGAAGCGGG - Intronic
1199307446 X:146283407-146283429 CCTTTTCCAGGTAAGGAAGCAGG + Intergenic
1199340991 X:146676979-146677001 CCATAACCACGTGAGGAAGCTGG + Intergenic
1200002237 X:153067992-153068014 CCACGACCATGTGAGGACGCAGG + Intergenic