ID: 1136628583

View in Genome Browser
Species Human (GRCh38)
Location 16:31476604-31476626
Sequence GGGGCTGGGGCGAGACGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136628583_1136628591 -1 Left 1136628583 16:31476604-31476626 CCTCGACGTCTCGCCCCAGCCCC 0: 1
1: 0
2: 2
3: 25
4: 259
Right 1136628591 16:31476626-31476648 CTCCGACCTCCGGAGTCCTCAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1136628583_1136628595 6 Left 1136628583 16:31476604-31476626 CCTCGACGTCTCGCCCCAGCCCC 0: 1
1: 0
2: 2
3: 25
4: 259
Right 1136628595 16:31476633-31476655 CTCCGGAGTCCTCAGGGCCATGG 0: 1
1: 0
2: 0
3: 30
4: 251
1136628583_1136628592 0 Left 1136628583 16:31476604-31476626 CCTCGACGTCTCGCCCCAGCCCC 0: 1
1: 0
2: 2
3: 25
4: 259
Right 1136628592 16:31476627-31476649 TCCGACCTCCGGAGTCCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 63
1136628583_1136628599 28 Left 1136628583 16:31476604-31476626 CCTCGACGTCTCGCCCCAGCCCC 0: 1
1: 0
2: 2
3: 25
4: 259
Right 1136628599 16:31476655-31476677 GTTTTCCTTCTGCTCTCTTCTGG 0: 1
1: 0
2: 3
3: 43
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136628583 Original CRISPR GGGGCTGGGGCGAGACGTCG AGG (reversed) Intronic
900151909 1:1182553-1182575 GGGGCTGGGACGAGACGAGGTGG + Intronic
900163832 1:1236901-1236923 GGGGCTGGGAGGAGACCTCAAGG - Intergenic
900166702 1:1246865-1246887 GGGGCTGGAGCGGGACCCCGGGG - Intergenic
900556921 1:3285231-3285253 GGGGCTGGGGCCAGAGGGCTGGG - Intronic
900963270 1:5939546-5939568 GGAGCTGGGGTGAGAAGTAGAGG - Intronic
902414184 1:16229388-16229410 GGGGCTGGGGAGAAACGGGGAGG + Intergenic
903373796 1:22853380-22853402 GGGGCTGGTGCCAGACCTCGGGG + Intronic
904773474 1:32893634-32893656 GGGGCAGGGGCGGGACGGGGTGG + Intronic
904784158 1:32973113-32973135 GGGGCGGGGGCGGGATGGCGAGG - Intergenic
905018046 1:34791101-34791123 AGGGCTGGGGAGTGACGTCAAGG - Intronic
906237711 1:44221879-44221901 GGGGCTGGGGCGGGACATGCCGG - Intronic
906534703 1:46544991-46545013 GGGGCTGGGGCAAGAGGCTGTGG - Intergenic
907217438 1:52877116-52877138 GGGGCTGGGGGGAGAGGGGGAGG - Intronic
907319561 1:53594070-53594092 GGGGCTGGGGTGAGGCCTGGCGG + Intronic
908354961 1:63319858-63319880 GGCGCGGGCGCGGGACGTCGGGG + Intergenic
914869071 1:151458662-151458684 CGGGCGGTGGCGAGACGGCGGGG - Intronic
914973497 1:152333952-152333974 GGGGTTGGGGGGAGAGGTGGAGG - Intergenic
915406374 1:155663002-155663024 GGGGATGGGGCGGGGTGTCGGGG - Intronic
917141627 1:171841420-171841442 GGGGCGGGGGCGGGGCGTCGCGG + Intergenic
918365665 1:183805195-183805217 GGGACCGGGGCGAGGCGCCGCGG + Intronic
920339742 1:205268324-205268346 TGGGCTGGGGCCAGGCGTAGTGG + Intronic
920340672 1:205273384-205273406 GGGTGTGGGGAGAGACGTGGTGG - Intergenic
920467901 1:206203719-206203741 GGGGCTGGGGCGGGAAGGAGAGG + Intronic
1065167433 10:22994348-22994370 GGGGCTGGCGTGAGAAGTGGGGG + Intronic
1067108062 10:43378521-43378543 GGGGCTGTGGGGAGAGGTAGGGG + Intergenic
1067945591 10:50686289-50686311 TGGGCTGAGGGGAGACGTTGAGG + Intergenic
1069846123 10:71372915-71372937 GGGGCGGGGGCGAGACAGTGAGG + Intergenic
1070011388 10:72478154-72478176 GGGGCTGAGGCCAGACGCCGTGG - Intronic
1070867102 10:79713162-79713184 TGGGCTGAGGGGAGACGTTGAGG + Intronic
1070880892 10:79851283-79851305 TGGGCTGAGGGGAGACGTTGAGG + Intergenic
1071634017 10:87235386-87235408 TGGGCTGAGGGGAGACGTTGAGG + Intronic
1071647463 10:87367603-87367625 TGGGCTGAGGGGAGACGTTGAGG + Intronic
1073357576 10:102869606-102869628 GGGGCTGGGGCGGGGCGCCCAGG - Intronic
1075463276 10:122632609-122632631 GGGGCAGGGGCCAGACTTCCAGG + Intronic
1076314448 10:129530930-129530952 AGGGCTGGGGCCACACTTCGGGG - Intronic
1076690295 10:132220261-132220283 GGGGCTGGGGGGATGCGTCTAGG + Intronic
1077204714 11:1336791-1336813 GGGGCGGGGGCGGGGCGTGGGGG + Intergenic
1077289175 11:1780962-1780984 GGGGCAGGGGAGCGACGTGGTGG + Intergenic
1078091817 11:8268654-8268676 GGCGCGGGGGCGAGACGGCCAGG + Intronic
1079296832 11:19241681-19241703 GGGGCCGGGGCGAGCGGGCGTGG - Intergenic
1080706450 11:34699747-34699769 GGGGCTGGGGAAAGAAGTAGGGG - Intergenic
1083595638 11:63917285-63917307 GGGGCCGGGGCCAGACCTCCAGG + Intergenic
1083656949 11:64234483-64234505 GGGGCGGGGGCGGGGCGGCGGGG - Intergenic
1083726228 11:64630090-64630112 GGGGGTGGGGGGAGAAGTGGAGG - Intronic
1083747710 11:64744861-64744883 GGGGCGGGGGCGGGGCGGCGGGG - Intronic
1083881887 11:65553050-65553072 GGGGCTGGGGCAAGACCCTGAGG - Intronic
1084143560 11:67250583-67250605 GGGGCTGGGGGGAGAGGAGGAGG + Exonic
1086151314 11:83613906-83613928 TGGGCTGGGGTGAGACATCAAGG + Intronic
1086397396 11:86431272-86431294 GGGGCTGAGGAGCGACGTGGGGG - Intergenic
1088604081 11:111512410-111512432 GGGGCGGGCGCGAGACGGGGCGG - Intergenic
1089254514 11:117187200-117187222 GGGGCTGGGGCGGGTGGTGGTGG + Intronic
1089289784 11:117430666-117430688 GGGGCTGGGGCCAGGGGGCGGGG + Intronic
1089624456 11:119742442-119742464 GGGGGTGGGGCGAGGGGTTGGGG - Intergenic
1091600617 12:1915697-1915719 GGGGCATGGGCGAGAGGTCGGGG - Intronic
1091698090 12:2641491-2641513 GGGGCTGGAGGGAGATGTCAAGG - Intronic
1094462787 12:30715500-30715522 GGGGCTGGGGGGAGAGGAGGAGG + Intronic
1096116823 12:49059981-49060003 CGGGCTCGGGCGGAACGTCGAGG + Intergenic
1096229523 12:49889370-49889392 GGGGCTGGGGAGAGAAGTAAAGG - Intronic
1096302977 12:50448150-50448172 GGGGCTGGGGCCAGACCTGGTGG - Intronic
1096336688 12:50762266-50762288 GGGGGAGGGGCTAGGCGTCGTGG - Intergenic
1096981172 12:55728868-55728890 GGGCCTGGGGCGAGCCCTGGAGG + Intronic
1098450114 12:70610071-70610093 GGGGCTGGGGCGAGGCAGCGCGG - Intronic
1099014239 12:77325492-77325514 GGGGGTGCGGGGGGACGTCGGGG + Intergenic
1102038060 12:109783360-109783382 GGGGCTGGGGCCTGAGGTGGAGG + Exonic
1103119831 12:118371978-118372000 GGGGCTGGGCTGAGACAGCGGGG - Intronic
1103741212 12:123092833-123092855 GGGGCTCGGGGGAGAGGTCGAGG - Intronic
1104382776 12:128322356-128322378 GGAGCTGAGGCAAGACGTCCTGG + Intronic
1104826104 12:131710775-131710797 GGGCCTTGGGCGAGTCCTCGTGG - Intergenic
1104989679 12:132618666-132618688 GGGGCCGGGGCGAGGCGGGGCGG + Intergenic
1107012290 13:35680871-35680893 GGGGCTGTGGCCAGAGGTCTTGG + Intergenic
1108368312 13:49740812-49740834 GGGGCTGGGGCCAGGGGTGGGGG - Intronic
1110596536 13:77326601-77326623 GGGGCTGGGGCTACCCGCCGCGG - Exonic
1112170479 13:96967552-96967574 GGGGGTGGGGCGTGGCGGCGGGG - Intergenic
1113085652 13:106567489-106567511 GGGGCCGGGGCGGGACGGTGCGG - Intronic
1115490011 14:33950227-33950249 GGAGCTGGGGCGAGGGGTGGGGG + Intronic
1119756570 14:77124114-77124136 GGGGCTGGGGTGAGGAGGCGTGG + Intronic
1121074910 14:91060196-91060218 GGGCCTGGGGCGGGGCGTCGCGG - Intronic
1121201581 14:92122225-92122247 GCGGCGGGGGCGAGTCCTCGGGG - Intronic
1121226402 14:92324356-92324378 AGGGCAGGGGCGAGACGCAGTGG - Intronic
1122230942 14:100306154-100306176 CGGGCCGGGGCGAGGCGTCCGGG - Intronic
1122666756 14:103334949-103334971 GGGGATGGGGCCAGACGCCCCGG + Intronic
1122809374 14:104280466-104280488 TGGGCTGGGGCCAGACGAGGTGG + Intergenic
1124619651 15:31266428-31266450 GGGGCTGGGGCGGGGCGGGGGGG - Intergenic
1125726363 15:41870257-41870279 GGGGCTGGAGCGAGAACTCGTGG - Exonic
1127396285 15:58546227-58546249 GGGGCTGGAGTGAGAAGTGGAGG - Intronic
1128255830 15:66195894-66195916 GGGGCTGGAGTAAGACGTGGTGG + Intronic
1129299265 15:74616030-74616052 GGGTCAGGGGTGAGAGGTCGCGG - Intronic
1129479002 15:75808233-75808255 GGGGCTGGAGGGAGACCTCATGG - Intergenic
1132669366 16:1096375-1096397 GGGGCTGGGGCCCGGCGTCTTGG + Intergenic
1132719499 16:1308967-1308989 GGGGCGCGGGCGGGACGTGGGGG - Exonic
1132950999 16:2562437-2562459 GGTGCTGGGGAGAGACGGGGAGG - Intronic
1132963350 16:2637733-2637755 GGTGCTGGGGAGAGACGGGGAGG + Intergenic
1133021104 16:2967351-2967373 GGGTCTGGGCCGAGCCCTCGGGG - Exonic
1134279362 16:12803893-12803915 GGGACTGGGGCGGGACGGGGAGG + Exonic
1136458303 16:30394975-30394997 GGGGCTGGTCCGAGAGGCCGAGG - Intronic
1136628583 16:31476604-31476626 GGGGCTGGGGCGAGACGTCGAGG - Intronic
1137270196 16:46898051-46898073 TGGGCTGGGAGGAGGCGTCGGGG + Intronic
1138611472 16:58128867-58128889 GGGACTGGGGCGCGAGGTGGGGG - Intronic
1139459441 16:67110064-67110086 GGGGCTGTGGCGGGCCGGCGGGG + Exonic
1139652346 16:68368685-68368707 AGGGCTGGGGGGAGAGGTCTGGG + Intronic
1141644443 16:85359748-85359770 GGCGCGGGAGCCAGACGTCGGGG - Intergenic
1142204831 16:88777977-88777999 GTGGCTGTGGCGAGACCTGGAGG - Intronic
1142240012 16:88940795-88940817 GGGGCTGCGGCGAAACTTCGAGG - Intronic
1142474332 17:180637-180659 GGGGCTGGGGCGAGCTGGGGAGG - Intronic
1142847765 17:2690467-2690489 TGGGGTGGGGTGAGACGTGGAGG + Exonic
1143390257 17:6555934-6555956 GGGGCTGGGGCGGGGGGTTGTGG + Intronic
1143740677 17:8951404-8951426 GAGGCTGGGGGGAGAAGTGGCGG - Intronic
1144724834 17:17496560-17496582 GGGGCTGGGGGGAGCAGTCCAGG + Intergenic
1145063956 17:19749479-19749501 GGGGCTGGGGTGAGAGTCCGTGG + Intergenic
1147556476 17:41482390-41482412 GGAGCAGGGGCCAGACTTCGGGG - Intergenic
1147701283 17:42396977-42396999 GGAGCTGAGGCGAGACATCCTGG + Intergenic
1151555265 17:74843305-74843327 TGGGCTGGGGCCAGACCGCGGGG + Exonic
1151876460 17:76870136-76870158 GGGGCTGGGCCGAGACCTGGAGG - Intronic
1151999124 17:77634249-77634271 GGTGCTGGGCTGAGACGTGGAGG + Intergenic
1152006178 17:77682902-77682924 GGGCCTGGGGCGAGAGGGAGAGG - Intergenic
1152036171 17:77874462-77874484 GGGGGTGGGGCGAGATGTTCGGG + Intergenic
1152269095 17:79313459-79313481 GGGTCTGGGGTGAGACCTCAGGG - Intronic
1152457355 17:80423973-80423995 GGGGCTGGGGCAAGGCGGGGTGG - Intronic
1152574626 17:81134619-81134641 GGGTCTGGGGTGAGAGGTCAGGG - Intronic
1152703334 17:81830347-81830369 GGGGCTGGGGCCAGGCGTGGTGG + Intronic
1203192138 17_KI270729v1_random:199748-199770 GGGGCGGGGGCGAAAAGCCGCGG - Intergenic
1155067450 18:22280026-22280048 GGGGCTGGGGACACACCTCGGGG + Intergenic
1157295008 18:46435927-46435949 GGAGCTGGGGAGAGAGGTTGAGG + Intronic
1157496662 18:48161707-48161729 GGGGCTGGGGCGGGGCGCCCGGG - Intronic
1160034794 18:75290588-75290610 GGGGCTGGGGGGAGAAGCCAGGG - Intergenic
1160225362 18:77007473-77007495 GGGGCTGGAGGGAGAAGTTGAGG + Intronic
1160230824 18:77047460-77047482 GGGGCTGGGGTGAGACGTGTCGG + Intronic
1160893721 19:1393162-1393184 GGGGATGGGGCGAGGCCTCGTGG + Intronic
1160930729 19:1568383-1568405 TGGGCCGCGGCGTGACGTCGCGG - Intergenic
1161251017 19:3280288-3280310 GGGGCTGGGGCTGGGCGTGGTGG + Intronic
1161344511 19:3761432-3761454 GGGGCTGGGTCCTGAAGTCGGGG - Intronic
1161473321 19:4472237-4472259 GGGGCGGGAGCGGGACGCCGAGG - Intergenic
1161644392 19:5444192-5444214 GGGGCAGGGGAGACAGGTCGGGG + Intergenic
1161949905 19:7462237-7462259 GGGGCTGGGGCAGGTCTTCGAGG - Exonic
1162064587 19:8117319-8117341 GGGGCTGGGGGGAGGGGTCCAGG + Intronic
1162299343 19:9835417-9835439 GGGGCTGGGGCGGGACTGCGCGG + Intronic
1162403809 19:10461687-10461709 GGGGCTGGGGCGGGACGGAGCGG + Intronic
1162752617 19:12838303-12838325 GAGCCTGGGGAGAGACGTGGCGG + Intronic
1162913567 19:13862822-13862844 AGGGCTGGGGCCAGGCGTGGTGG - Intronic
1163578303 19:18123380-18123402 GGGGCTGGGGCCAGAGGTCGCGG - Intronic
1163634963 19:18433473-18433495 GGGGCGGGGGCGCGTCGGCGGGG + Intronic
1164468253 19:28506403-28506425 GGGGCTGGGGTGAGGGGTGGTGG - Intergenic
1165721302 19:38081750-38081772 GGGGCTGGGGCGGGTGGTGGCGG - Exonic
1165829716 19:38724360-38724382 GGGGCTGGGGCAGGACGGCGGGG + Intronic
1166055438 19:40285354-40285376 GGGGCTGGGGGGAGGGGGCGGGG - Exonic
1167842540 19:52133798-52133820 GGTGATGGGGCCAGACGTGGTGG - Intronic
1168294159 19:55370496-55370518 GGGGCTGGGGCGGGCGGGCGGGG + Intergenic
925034806 2:677046-677068 GGGGCCGGGGCCGGGCGTCGGGG - Intronic
925153212 2:1631404-1631426 GGCTCTGGGGCCAGAAGTCGGGG - Intergenic
928042323 2:27890706-27890728 GGGGGCGGGGCGGGACGTCCGGG + Exonic
928737841 2:34313092-34313114 GGGGCTGGGGCCAGGTGTGGTGG + Intergenic
930358143 2:50346501-50346523 GGGGATGGGGGAAGGCGTCGCGG - Intronic
930712067 2:54558724-54558746 GGGGCTGGAGCGAGATTTCCAGG + Intronic
931052341 2:58428571-58428593 GGGGCTGGGGCGATCCGGTGGGG - Intergenic
932073802 2:68644835-68644857 GGGGCTGGGGTGAGGGGTCTAGG - Intronic
933847406 2:86337232-86337254 GGGGCTGGGCCGGGACGGCGAGG - Intronic
934950000 2:98569767-98569789 GGGGCTGGGCCAAGAAGTCGTGG + Intronic
937018926 2:118633060-118633082 GGGGCGGGGGCGGGGCGTGGTGG - Intergenic
942292576 2:174487077-174487099 GGGGCGGGGGCGGGGCCTCGCGG - Exonic
945251292 2:207768307-207768329 GGTGCTGGGCCGCGACGCCGAGG - Exonic
948207115 2:236168199-236168221 GGGGCTCCGGCGAGCCCTCGGGG - Exonic
948874502 2:240819694-240819716 GGGGCTGCGCCCAGACGGCGGGG - Intronic
948876068 2:240829699-240829721 GGGGCTGGGATGAAACGTGGTGG + Intergenic
1169132677 20:3174021-3174043 GGGGTCGGGACGAGCCGTCGCGG + Intergenic
1169198897 20:3698061-3698083 GGGGCCGGGGCTGGACGGCGAGG - Exonic
1171449404 20:25225327-25225349 GGGGCTGGGGCGTGACCTGAGGG - Intronic
1173618130 20:44416124-44416146 GGGGGTGGGCCGGGAGGTCGGGG - Intronic
1174063378 20:47847530-47847552 GGGGCTGGGGAGAGAGGCAGAGG - Intergenic
1174146668 20:48456830-48456852 GGGGCTGGGGAGAGAGGCAGAGG - Intergenic
1174151726 20:48490563-48490585 GGGGCTGGGGAGAGAGGCAGAGG - Intergenic
1175398517 20:58685006-58685028 GGGGCTGGGGCCAGGCATGGTGG - Intronic
1175544785 20:59771229-59771251 GGGGCTGGGGTGAGAAGTAGAGG + Intronic
1176194691 20:63831587-63831609 GGGGCTGGGGCGGCGCGGCGCGG + Intergenic
1176412003 21:6454175-6454197 GAGGCTGGGGTGAGACCTCTGGG - Intergenic
1176604871 21:8820353-8820375 TGGGCTGGCGCGGGACGTCCCGG - Intergenic
1179687497 21:43062497-43062519 GAGGCTGGGGTGAGACCTCTGGG - Intronic
1179818699 21:43923905-43923927 GGGGCTGGGGAGTGCTGTCGAGG + Intronic
1180347161 22:11711958-11711980 TGGGCTGGCGCGGGACGTCCCGG - Intergenic
1180354911 22:11830048-11830070 TGGGCTGGCGCGGGACGTCCCGG - Intergenic
1180383340 22:12162283-12162305 TGGGCTGGCGCGGGACGTCCCGG + Intergenic
1180994658 22:19959538-19959560 GGGGCTGGGGCGGGGCGGAGCGG + Intronic
1181514034 22:23401536-23401558 GGGGCTGGCACGGGACGTCCAGG - Intergenic
1182289490 22:29267181-29267203 GGGGCTGGGGCTAGAGGTCCAGG + Intronic
1183703035 22:39460508-39460530 GGCGCTGAGGCGAGGCGTGGTGG + Intronic
1184177364 22:42795877-42795899 GGGGCTGGGGGGAGACTGAGGGG + Intergenic
1184405930 22:44300835-44300857 GGGGCGGGGGCGGCACGTGGGGG - Intronic
1185187540 22:49411314-49411336 AGGGCTGGGTCCAGACGTTGGGG - Intergenic
1185337329 22:50276498-50276520 GAGGGTGGGGCGGGACCTCGAGG - Intronic
1185374184 22:50474657-50474679 GGGGCTGGGTCGGGAGGCCGAGG - Intronic
949968992 3:9386358-9386380 GGGGGTGGGGAAAGACATCGTGG - Exonic
950095939 3:10330488-10330510 GGGGCTGGGACGAGAGGAGGAGG - Intronic
954113129 3:48446889-48446911 CGGGCCGGGGCGAGGCGCCGGGG - Exonic
954367789 3:50155437-50155459 GGCGCAGCGGCGAGAGGTCGCGG + Exonic
954484912 3:50839026-50839048 AGGGCTGGGGCAAGAGGTTGGGG + Intronic
958023922 3:88028226-88028248 GGGGCTGGGGTGAGCCCACGTGG - Intergenic
961634356 3:128323586-128323608 GGGGCTATGGCGAGAAGTCAAGG - Intronic
962809326 3:138947533-138947555 TGGGGAGGGGCGAGACGGCGAGG + Intronic
963798444 3:149654834-149654856 AGGGCTGGGGCCAGGCGTGGTGG + Intronic
964110524 3:153082721-153082743 GGGGTTGTGGGGAGATGTCGAGG + Intergenic
968478995 4:825761-825783 GGGGCTGCGGGGAGAAGCCGGGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969457555 4:7308749-7308771 GGTGCTGGAGCGAGACGACAGGG - Intronic
969829214 4:9781650-9781672 GGGGCTGGGGCAGGCAGTCGCGG - Intronic
970613060 4:17743260-17743282 GGGGGTGGGGAGAGAGCTCGTGG + Intronic
973373251 4:49270584-49270606 TGGGCTGGCGCGGGACGTCCCGG + Intergenic
975983597 4:80184281-80184303 GGGGCGGGGGCGGGACGCCGGGG - Intronic
981695060 4:147551518-147551540 GGGGCAAGGGAGAGACGTGGGGG + Intergenic
983234145 4:165159940-165159962 GGAGATGGGGCTAGGCGTCGTGG - Intronic
984778846 4:183505825-183505847 GGGGAGGGGGCGAGAGGCCGCGG + Intronic
985630186 5:1009866-1009888 GGGGCTGGACCTAGACGTCCCGG + Intronic
986683659 5:10256601-10256623 GAGGCTGAGGTGAGAGGTCGAGG + Intronic
988421872 5:31015572-31015594 GGGGCGGGGGCGAGGCATGGAGG + Intergenic
988486038 5:31668930-31668952 GGGGCTGGGGCTGGACCTCAGGG + Intronic
988771708 5:34439363-34439385 GGGGCTGGTGCTAGAAGTAGAGG - Intergenic
997585018 5:135038956-135038978 AGCGCTGCGGCGGGACGTCGGGG + Intronic
998199458 5:140108001-140108023 CGGGCGGGGGCGGGACGCCGAGG - Intronic
1001307383 5:170585444-170585466 GAGGCTGGGGAGAGGCTTCGGGG - Intronic
1001470149 5:172006338-172006360 GGGTCTGGGTCGAGGCGTCTGGG + Intronic
1002061757 5:176629699-176629721 GGGGCTGGGGTGAGAGTGCGGGG - Intronic
1002641012 5:180630699-180630721 GGGGGTGGTGCGAGACTGCGAGG - Exonic
1005094693 6:22102140-22102162 GAGGCTGAGGTGAGAGGTCGAGG - Intergenic
1005511709 6:26517815-26517837 GGCACTGGGGCAAGACCTCGGGG + Intergenic
1005896832 6:30185852-30185874 GGGGCTGGGGGCAGATGTCAGGG + Exonic
1006414071 6:33893063-33893085 GGGGCCGGGGCGAGGGGGCGGGG + Intergenic
1007629529 6:43265118-43265140 GGGGCTGGGGAGAGTCATGGAGG + Intronic
1007634657 6:43291638-43291660 AGGGCTGGGGAGGGGCGTCGAGG - Intergenic
1007765183 6:44155663-44155685 GGGGCTGGGGAGAGACTTAAGGG + Intergenic
1008510025 6:52267491-52267513 GGGACTGGGGAGAGAAGTAGAGG - Intronic
1013586998 6:111588297-111588319 GGGGTTGGGGAGAGACATCTAGG - Intronic
1014632517 6:123803839-123803861 GCGGCAGGGGCGAAACTTCGCGG + Intergenic
1015151925 6:130049756-130049778 GGAGCTCGGGGGAGAGGTCGGGG - Exonic
1015999520 6:139029018-139029040 CCGGCTGGGCCGAGACCTCGCGG + Intronic
1016329952 6:142945369-142945391 GGGGCTGGGGGCACACGCCGGGG + Intergenic
1017002297 6:150005006-150005028 GGGGCTGGGGCCAAACTTGGCGG - Intergenic
1018035273 6:159876211-159876233 GGGGCAGGGGAGAGCCTTCGGGG - Intergenic
1019609663 7:1930276-1930298 GGGGATGGGGCGAGGTGACGTGG - Intronic
1019609694 7:1930359-1930381 GGGGATGGGGCGAGGGGACGTGG - Intronic
1019609725 7:1930441-1930463 GGGGATGGGGCGAGGGGACGTGG - Intronic
1019609736 7:1930469-1930491 GGGGATGGGGCGAGGGGACGTGG - Intronic
1020083115 7:5296863-5296885 GGGGCTGGGGCGGGACGGGGCGG + Intronic
1022342884 7:29485686-29485708 GGTGCAGGGGAGAGACCTCGGGG + Intronic
1025211178 7:57020346-57020368 GGGGCTGGGGCGGGGCGGAGCGG - Intergenic
1025211188 7:57020367-57020389 GGGGCTGGGGCGGGGCGGAGCGG - Intergenic
1025249939 7:57344804-57344826 GGGCCTGGTGTGAGACTTCGGGG + Intergenic
1025258891 7:57404165-57404187 AGGGGTGGGGCGAGACGGAGGGG + Intergenic
1025660767 7:63556480-63556502 GGGGCTGGGGCGGGGCGGAGCGG + Intergenic
1025660777 7:63556501-63556523 GGGGCTGGGGCGGGGCGGAGCGG + Intergenic
1025944031 7:66092749-66092771 GGGGCTGGGGAGAGAGGAAGAGG - Exonic
1029381932 7:100220467-100220489 GGGGCCGGGGCGAGGGGTCCAGG + Intronic
1029660565 7:101958290-101958312 GGGGCTCAGGAGAGACGTAGTGG + Intronic
1029746431 7:102517813-102517835 GGGGCGGGGGCGGGGCGGCGGGG + Intergenic
1029764368 7:102616792-102616814 GGGGCGGGGGCGGGGCGGCGGGG + Intronic
1032086108 7:128884738-128884760 GGGGCTGGGGCACCTCGTCGGGG - Intronic
1034595222 7:152183472-152183494 GGGGCTGGGGCCAGGCATGGTGG + Intronic
1035555243 8:562821-562843 GGGGCCTGGGCGAGAGGTCCGGG + Intergenic
1037481981 8:19313833-19313855 GGGGGTGGGGCGAGGCTTTGGGG + Intronic
1041244999 8:55880651-55880673 CGGGCAGGAGCGTGACGTCGAGG + Intronic
1043463898 8:80486707-80486729 GGGGCGGGGGCGAGACAGAGGGG + Exonic
1045216935 8:100158185-100158207 GGAGCGGGGGCGAGAGGTCGAGG + Intronic
1046745828 8:117875127-117875149 GGGGATGGGGCCAGGCGCCGTGG + Intronic
1048472075 8:134712809-134712831 GGGGTTGGGGTGAGACGGGGTGG - Intronic
1049408582 8:142462513-142462535 CAGGCTGGGGCCAGACCTCGAGG + Intronic
1049410809 8:142473237-142473259 GGGGCTGGGCTGGGACGGCGAGG + Intronic
1049544967 8:143226258-143226280 TGGGCTGGGGAGAGAAGTCCAGG - Intergenic
1049665552 8:143841130-143841152 GGGACTGGGGCGGGGCTTCGCGG - Intergenic
1049879409 8:145052151-145052173 GGGGCTGGGGCGGGGCCTGGGGG - Intergenic
1051406046 9:16738815-16738837 GGGGCTGGGGCGGGAGGATGGGG - Intronic
1053323499 9:37120728-37120750 GGGGCGGACGGGAGACGTCGAGG - Exonic
1054351634 9:64021458-64021480 TGGGCTGGCGCGGGACGTCCCGG - Intergenic
1057353339 9:94317767-94317789 TGGGCTGAGGGGAGACGTTGAGG - Intergenic
1057654412 9:96939825-96939847 TGGGCTGAGGGGAGACGTTGAGG + Intronic
1058908126 9:109497997-109498019 GGGGCCGGGGCGGGAGGGCGCGG - Intronic
1060389725 9:123268023-123268045 GGAGCTGGGGAGAGGCTTCGGGG - Intronic
1061005674 9:127927512-127927534 GGGGGTGGGGCCATACGTGGGGG - Intronic
1061087753 9:128409212-128409234 CGAGCTGGGGCGAGATGTTGGGG + Intergenic
1062535335 9:137018687-137018709 GGGGCTGGGGCGGGGCGGGGAGG + Intronic
1062707847 9:137955048-137955070 GGGGCTGGGGTGAGATGTCGGGG + Intronic
1203696963 Un_GL000214v1:108587-108609 TGGGCTGGCGCGGGACGTCCCGG + Intergenic
1190755983 X:53402576-53402598 GGGGTTGGGGCCAGGCGTGGTGG + Intronic
1192135680 X:68597464-68597486 GAGGCTGGGGAGAGTAGTCGGGG + Intergenic
1192226333 X:69230756-69230778 GGGGCTGGGGCCAGATGCTGAGG - Intergenic
1193743371 X:85244594-85244616 GGGGCGGGGGCGAGGCGACTGGG - Intronic
1195803391 X:108736425-108736447 GGGGCTGGGGCGGGCAGACGAGG - Intergenic
1200213788 X:154358560-154358582 GGGGCTGGGGCCAGGCCTGGTGG - Exonic
1201153532 Y:11108015-11108037 TGGGCTGGCGCGGGACGTCCCGG - Intergenic
1202368633 Y:24183059-24183081 GGGGCTGGGGCGGGGCCTCAGGG - Intergenic
1202502152 Y:25487058-25487080 GGGGCTGGGGCGGGGCCTCAGGG + Intergenic