ID: 1136630917

View in Genome Browser
Species Human (GRCh38)
Location 16:31488809-31488831
Sequence GGTGCGCAAGCCCCCGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 181}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136630917_1136630923 -6 Left 1136630917 16:31488809-31488831 CCCGGGGCGGGGGCTTGCGCACC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1136630923 16:31488826-31488848 CGCACCTGCAGGGGAGCCCAGGG 0: 1
1: 0
2: 2
3: 13
4: 228
1136630917_1136630926 0 Left 1136630917 16:31488809-31488831 CCCGGGGCGGGGGCTTGCGCACC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1136630926 16:31488832-31488854 TGCAGGGGAGCCCAGGGTCCGGG 0: 1
1: 0
2: 3
3: 66
4: 486
1136630917_1136630931 26 Left 1136630917 16:31488809-31488831 CCCGGGGCGGGGGCTTGCGCACC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1136630931 16:31488858-31488880 GATCCGACGGCCTCCGCCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 116
1136630917_1136630925 -1 Left 1136630917 16:31488809-31488831 CCCGGGGCGGGGGCTTGCGCACC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1136630925 16:31488831-31488853 CTGCAGGGGAGCCCAGGGTCCGG 0: 1
1: 1
2: 7
3: 54
4: 551
1136630917_1136630929 13 Left 1136630917 16:31488809-31488831 CCCGGGGCGGGGGCTTGCGCACC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1136630929 16:31488845-31488867 AGGGTCCGGGTTCGATCCGACGG 0: 1
1: 0
2: 0
3: 2
4: 11
1136630917_1136630922 -7 Left 1136630917 16:31488809-31488831 CCCGGGGCGGGGGCTTGCGCACC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1136630922 16:31488825-31488847 GCGCACCTGCAGGGGAGCCCAGG 0: 1
1: 0
2: 1
3: 35
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136630917 Original CRISPR GGTGCGCAAGCCCCCGCCCC GGG (reversed) Intronic
900205147 1:1428243-1428265 GGGGCGCAGGCCCCAGCCCAAGG + Intergenic
900625073 1:3604257-3604279 GGTGGGCAAGCCTCAGCCCTGGG - Intronic
901367304 1:8763794-8763816 GGTGCGCATGCCACCACACCCGG - Intronic
902329946 1:15726409-15726431 GGGGAGCAATCCCCCGCCTCAGG - Intronic
902393580 1:16120069-16120091 GGTGCCCAAGGCCCCATCCCAGG + Intergenic
903233895 1:21937394-21937416 GGAGCGCCAGGCCCCGCCCACGG + Intergenic
905874977 1:41426802-41426824 GTGGCCCAAGCCCCCGCCACCGG + Intergenic
911855599 1:102871666-102871688 AGTGCGTAAGCCCCCACACCTGG - Intergenic
918232795 1:182551039-182551061 GGTGCTCCAGCCCCCTCCACTGG + Intronic
919775998 1:201194328-201194350 GGTGCCCCAGCCCTCTCCCCTGG - Intronic
920706209 1:208252494-208252516 GGTGCGGGAGCCCCAGCTCCTGG + Intergenic
922536839 1:226387260-226387282 GGTGCTCAAGCCACTGCACCCGG + Intronic
922539608 1:226408681-226408703 GAAGCGCAGGCCCCCGCCTCGGG + Intergenic
922898416 1:229118160-229118182 GGTGCGCCAGCCCCCGCCCTGGG + Intergenic
923208149 1:231778247-231778269 GGAAAGCAAGGCCCCGCCCCAGG + Intronic
924188213 1:241519241-241519263 GGCGCGCAGGCCCCCAGCCCCGG - Intronic
1067834936 10:49632665-49632687 GGTGGAAAAGCCCCTGCCCCAGG - Intronic
1069625721 10:69866617-69866639 GGTGAGCAAGCCCCAGGCCCGGG - Intronic
1069883244 10:71607211-71607233 GCAGCCTAAGCCCCCGCCCCTGG - Intronic
1070973102 10:80583523-80583545 GGCGCGCATGCCACCACCCCTGG - Intronic
1072804649 10:98416898-98416920 GGTTCTCAAGCCCCTGGCCCTGG - Exonic
1073510202 10:104038088-104038110 CGTGCGCCAGCCTCCTCCCCAGG + Intronic
1074878447 10:117632568-117632590 GGTGCCCACGCTTCCGCCCCAGG + Intergenic
1076071152 10:127490760-127490782 TGTGTGCCAGCCCCCGCACCAGG - Intergenic
1076704687 10:132294725-132294747 AGTGCACCAGCCCCCGACCCAGG + Intronic
1076853748 10:133105338-133105360 CGTGTGTAAGCCCCCGTCCCCGG + Intronic
1077172738 11:1175249-1175271 GGAGGCCAAGCCCCCGCCCCAGG + Intronic
1077201359 11:1309190-1309212 CGGGCGCAGGCCCCCTCCCCCGG + Intronic
1077254662 11:1574762-1574784 GGAGCGCGCGTCCCCGCCCCAGG - Intergenic
1077539437 11:3139620-3139642 TCTGGACAAGCCCCCGCCCCAGG + Intronic
1078390276 11:10931105-10931127 CGCGCTCCAGCCCCCGCCCCGGG + Intergenic
1078561539 11:12377415-12377437 GGGGCGCAAGGCGCGGCCCCGGG + Exonic
1082787375 11:57324489-57324511 GCCGCGCTAGCCCCCTCCCCCGG - Intronic
1083669255 11:64291330-64291352 GGTCCGCAACTCTCCGCCCCTGG - Intronic
1084265568 11:68003673-68003695 GGTGAGCATGCCCCCGGCGCTGG + Exonic
1085266503 11:75240834-75240856 GGAGCGGAGCCCCCCGCCCCCGG - Intergenic
1085456291 11:76667279-76667301 GGTGAACAAGCCACCGGCCCAGG + Intronic
1085507113 11:77066946-77066968 CGAGCGCCAGCCCCCGCCGCAGG + Exonic
1085865178 11:80282394-80282416 GGTGTCCAAGCCCCCCCTCCAGG + Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1089966076 11:122655952-122655974 GGTCCCCGAGCCCCCTCCCCTGG + Exonic
1090788366 11:130069626-130069648 CGCGCGCACGCCCCCGCGCCTGG + Intergenic
1091215283 11:133897515-133897537 GGTCCCCAAGACCCAGCCCCAGG + Intergenic
1091831966 12:3556416-3556438 GTTGAGCAAGCCCCCCTCCCTGG - Intronic
1091923020 12:4320992-4321014 GGTGCGGGAGGCCCCGCCCGCGG - Intergenic
1095094265 12:38137268-38137290 GGCGCGCATGCCACCGCGCCCGG - Intergenic
1096654315 12:53079197-53079219 AGAGCGCAGGGCCCCGCCCCTGG + Intronic
1097013104 12:55966957-55966979 GGTTCCCAGGCCCCCGCTCCAGG + Exonic
1103563468 12:121804277-121804299 GCGGCCCAAGCCCCCGGCCCCGG + Intronic
1106408464 13:29494656-29494678 GGCGCGCAAGCCCCCACCTGCGG + Intronic
1116821881 14:49634528-49634550 GCTGCGCACGCCCCTGCCCGGGG - Exonic
1117443469 14:55780994-55781016 GGTGGGACAGCCCCAGCCCCAGG + Intergenic
1119494132 14:75064018-75064040 GGCGCGCAAACCTCCGCGCCCGG + Exonic
1119982137 14:79093780-79093802 GGTGAGCAAGCTCCAGCCTCAGG - Intronic
1121210192 14:92202614-92202636 GTTGCCCAAGCCCCACCCCCAGG - Intergenic
1122599149 14:102912628-102912650 GGAGCGCAGGCCCCCACCACAGG - Intergenic
1122716487 14:103699606-103699628 GGTCAGCAAGTCCCCGCCCCAGG + Intronic
1122785106 14:104159958-104159980 GGAGCTTCAGCCCCCGCCCCAGG + Intronic
1122789572 14:104178632-104178654 GGTGGACCTGCCCCCGCCCCTGG + Exonic
1123036816 14:105474994-105475016 GGTGCGCCCGGCCCCGGCCCCGG + Intronic
1123104965 14:105837014-105837036 GATGCGCCAGCCCCTGCCCCCGG - Intergenic
1202857262 14_GL000225v1_random:59083-59105 ACTTCGCCAGCCCCCGCCCCCGG + Intergenic
1124127134 15:26946077-26946099 GGTCCTCATGCCCCTGCCCCTGG + Intronic
1126634216 15:50765730-50765752 GATGCGGAAACCCCCGCGCCGGG + Exonic
1127461917 15:59206814-59206836 GGTGCGCGTGCCCCGCCCCCTGG - Exonic
1130735233 15:86541232-86541254 GATGCTCATGCCCCAGCCCCAGG - Intronic
1132286801 15:100669383-100669405 GGTGCTCCAGCAGCCGCCCCTGG - Intergenic
1132465982 16:77691-77713 TGTGCGGAGGCCCCCGCCCCTGG - Intronic
1132609172 16:806695-806717 GGCGCGCAGGCCACCACCCCTGG - Intronic
1132640779 16:977386-977408 GCTGGGAAAGGCCCCGCCCCCGG - Intronic
1132720932 16:1315299-1315321 GTTCTGCAAGCCCCTGCCCCAGG - Intronic
1132806140 16:1776016-1776038 GGTGCAGAAGCCCCGTCCCCAGG + Intronic
1132932887 16:2467853-2467875 GGTGCGCCAGACCCGGCCCGGGG - Intergenic
1134793624 16:17014011-17014033 AGTGCGCAAGCTCTCGCCCCTGG + Intergenic
1136234641 16:28905987-28906009 GGGGCACAAGCCCCCAGCCCCGG - Intronic
1136459474 16:30400654-30400676 GGGTCGCAAGTTCCCGCCCCCGG + Intergenic
1136630917 16:31488809-31488831 GGTGCGCAAGCCCCCGCCCCGGG - Intronic
1138522088 16:57576824-57576846 GGTGCTCAGGGCCCTGCCCCAGG + Exonic
1140959161 16:79895889-79895911 GGTGGGGACGCCCCCACCCCCGG - Intergenic
1141625502 16:85259171-85259193 GGGGCACGAGCCCCCGCCCCTGG - Intergenic
1142155230 16:88529967-88529989 GCTGGGCAAGCCACTGCCCCAGG + Intronic
1142810264 17:2392836-2392858 GGCGCGCCAGCCCCGCCCCCTGG + Intronic
1143194646 17:5066607-5066629 CGTGAGCCAGCCCCCACCCCCGG - Intergenic
1143195359 17:5072114-5072136 TGGGCGTGAGCCCCCGCCCCCGG + Intergenic
1143540108 17:7563544-7563566 GGTGTGCGAGGCCCCGCCGCCGG - Exonic
1145777137 17:27537039-27537061 GGTGGGGGAGCCCCCGCTCCTGG - Intronic
1147326019 17:39670014-39670036 CGTGCACCAGCCCCAGCCCCTGG + Exonic
1147339627 17:39745808-39745830 GTTGAGGCAGCCCCCGCCCCAGG - Intronic
1148734577 17:49858273-49858295 GGTGGGCATGCTCCTGCCCCGGG - Intergenic
1150549045 17:66192116-66192138 AGCGCGAAAGTCCCCGCCCCCGG - Intergenic
1151680364 17:75619799-75619821 GGTGCGCTAGCCCACGACCCTGG + Intergenic
1152093247 17:78258370-78258392 GGTTCGCCATCCCCTGCCCCTGG + Intergenic
1152361516 17:79835209-79835231 GGCGGGCAAGCCCCCGCCGCCGG - Exonic
1152570719 17:81120153-81120175 GGAGCGCGACCCCCAGCCCCGGG + Intronic
1152711036 17:81870744-81870766 GGCGCGGAGGCCCCAGCCCCTGG - Intronic
1152755111 17:82083957-82083979 CGTGGGTAAGGCCCCGCCCCCGG - Exonic
1152760268 17:82103855-82103877 GGTGAGCTGGCCCCCTCCCCAGG + Intronic
1154070807 18:11149695-11149717 GGAGGGCAAGCCCCCACCCGCGG + Intergenic
1158568283 18:58574483-58574505 GGTCCCCAACCCCCAGCCCCAGG + Intronic
1160759375 19:775342-775364 GCTGCCCAAGTCCCCTCCCCGGG + Intergenic
1161027105 19:2041821-2041843 GGTGCGCGGGCCGCCGCACCTGG + Exonic
1161043784 19:2123750-2123772 GGTGGGCAAGCTCCCGCCTGTGG + Intronic
1161161343 19:2763256-2763278 GGGGCGCAGGCTCCTGCCCCGGG + Intronic
1161247115 19:3259263-3259285 GGTGATCCTGCCCCCGCCCCAGG + Intronic
1161413453 19:4130419-4130441 GGTGCGCGTGCCACCACCCCCGG + Intergenic
1163518521 19:17778922-17778944 GGCGCTCAATCCCCCGCCCAGGG - Intronic
1163530074 19:17843694-17843716 GGTGCCCACACCCCTGCCCCAGG - Intronic
1163851815 19:19668715-19668737 GGTGCCCCAGGTCCCGCCCCTGG - Intergenic
1164840695 19:31390200-31390222 GGTCAGCAAGACCCAGCCCCAGG - Intergenic
1165750487 19:38256424-38256446 CGAGCCCGAGCCCCCGCCCCCGG - Exonic
1165757993 19:38305158-38305180 GCTGCACAGGCCACCGCCCCAGG - Exonic
1166038974 19:40191200-40191222 GGAGCGCTTCCCCCCGCCCCGGG + Intergenic
1166851817 19:45764985-45765007 GCTGCCCCACCCCCCGCCCCTGG + Exonic
1167040553 19:47020615-47020637 GGCACGCACGCCCCAGCCCCCGG - Intronic
1167156767 19:47743374-47743396 GGTTCCCAGGCCCCCGCCGCGGG - Intergenic
1167376328 19:49114326-49114348 GCTGCGCGAGGCCACGCCCCGGG - Intronic
1167516763 19:49928045-49928067 GGTGCCCAGGCCCCATCCCCTGG - Exonic
1167709065 19:51099048-51099070 AGAGCCCAGGCCCCCGCCCCGGG + Exonic
1167781376 19:51601270-51601292 AGAGCCCAGGCCCCCGCCCCGGG - Intergenic
1168110979 19:54191185-54191207 CGAGCGCCAGGCCCCGCCCCCGG - Intronic
1168239523 19:55082180-55082202 GGTGAGGACGCGCCCGCCCCTGG + Exonic
1168325626 19:55537165-55537187 GGGTCGTAAGGCCCCGCCCCTGG + Intergenic
925044376 2:760715-760737 GATGGGCAGGCCCCAGCCCCAGG + Intergenic
927698408 2:25252425-25252447 GGAGCGCCGGCCCCCTCCCCGGG - Intronic
930035654 2:47083663-47083685 AGTGCCCAAGCCCCAGACCCTGG - Intronic
930124099 2:47783047-47783069 TGCGCGCCAGGCCCCGCCCCCGG - Intronic
932486002 2:72084752-72084774 GGTGCGGCAGCCCCCGTCTCTGG - Intergenic
932522305 2:72427252-72427274 GGACCTCAAGCCCCCACCCCAGG + Intronic
938423432 2:131163554-131163576 GGTGCGTGAGCCACCGCGCCCGG + Intronic
938796135 2:134719221-134719243 GGTGCGCCGGCTCCCGCGCCCGG - Intergenic
939071677 2:137551847-137551869 GATGCTCAAGCCCCAGGCCCAGG - Intronic
947983233 2:234427360-234427382 GGCTCTCAAGCCCCAGCCCCAGG - Intergenic
948353508 2:237359783-237359805 GGTGCCCACGGCCCCGGCCCTGG - Intronic
1168832889 20:856625-856647 GGTGGGCATGACACCGCCCCGGG + Intronic
1171173577 20:23035389-23035411 TGCGCGCCAGCCCCCGCCCTGGG + Exonic
1174358390 20:50013072-50013094 AGTGCCCAAGCCCCGCCCCCAGG - Intergenic
1176046984 20:63097742-63097764 GGTGCGACAGCCCCATCCCCAGG - Intergenic
1176285461 21:5016787-5016809 GGTGCCTAAGACCCCCCCCCCGG - Intergenic
1179605722 21:42514046-42514068 AGTGCGCAGGGCCCCGCGCCCGG - Exonic
1179629168 21:42666098-42666120 GGTGGCCACGCCCCCACCCCAGG - Intronic
1179871720 21:44246688-44246710 GGTGCCTAAGACCCCCCCCCCGG + Intronic
1181041360 22:20194170-20194192 GGGCAGCAAGCACCCGCCCCTGG + Intergenic
1181162108 22:20965283-20965305 GGAGCGCAAGCGCTGGCCCCCGG - Intronic
1182122839 22:27798344-27798366 GGAGCGCCGGCCCCCGCCGCCGG - Exonic
1183211241 22:36452706-36452728 GGTGTGCAAATCCCCACCCCAGG + Intergenic
1184098358 22:42328808-42328830 GGGGGGAAAGCCCCCACCCCAGG + Intronic
1184241282 22:43212468-43212490 GGTGAGCAAACCCCCTCCACAGG + Exonic
1184883627 22:47328393-47328415 TGTGCCCCAGCCCCAGCCCCCGG - Intergenic
1185217476 22:49609749-49609771 CCTGCTCAAGCCCCCACCCCAGG + Intronic
953099207 3:39809335-39809357 GGGGCGCGGGTCCCCGCCCCGGG + Intronic
961346210 3:126265047-126265069 GGGGCGCAAGCCACCTCCCCTGG + Intergenic
964803414 3:160580040-160580062 GGGGCGTAAGCCACCGCACCCGG - Intergenic
966200971 3:177359395-177359417 GGTGGGAAAGGCCACGCCCCGGG + Intergenic
968511429 4:997489-997511 GGTCCCCACGTCCCCGCCCCTGG - Intronic
969394281 4:6910300-6910322 GGTGCGCCAGACCCCGACCCCGG + Intronic
977957967 4:103052350-103052372 GGTGCCCAAGCCCCGGGCCGTGG - Intronic
983680989 4:170353375-170353397 GGTGTGCAAGGTCCAGCCCCAGG + Intergenic
985323290 4:188738464-188738486 GGTCCGCAAGGGCCCGCCCCGGG - Intergenic
985785400 5:1890594-1890616 GGGGCTCAAGCTCCCACCCCTGG - Intergenic
990175993 5:53109547-53109569 GGCGCCCCCGCCCCCGCCCCCGG - Exonic
992269709 5:75052745-75052767 GCTGCCCGAGCCCCCGCCCCTGG - Intergenic
1000042923 5:157498394-157498416 GGTGCCCAAGGCCCCGCTGCCGG - Intronic
1000340605 5:160274568-160274590 GGTGGGAAAGCCCCCGTCTCTGG - Intronic
1001159455 5:169300710-169300732 GGTGTGCAGGGCCCCGCTCCTGG + Exonic
1006362220 6:33593035-33593057 GGGGAGCCAGGCCCCGCCCCAGG + Intergenic
1017313547 6:153002551-153002573 GGTCCGCAAGGGCCCGCCCCGGG + Exonic
1017810688 6:157981692-157981714 GCTGCGCGAGGCCGCGCCCCGGG - Intergenic
1017966459 6:159271097-159271119 GGTGGGGAAGACCCCACCCCAGG + Intronic
1019685035 7:2377075-2377097 GGTCAGCATGCCCCCACCCCCGG + Exonic
1019765011 7:2843788-2843810 GGGGCGCTAACCCCCGCCCCGGG - Intronic
1019923182 7:4175579-4175601 GGTGCGGCAGCCCCCGCAACTGG + Intronic
1019986601 7:4660998-4661020 CAGGCGCAAGCCACCGCCCCCGG - Intergenic
1020076786 7:5263635-5263657 TCTGGGCAGGCCCCCGCCCCAGG - Intergenic
1020081996 7:5291237-5291259 GGTGCGCTGGGCCCCGCCACGGG + Exonic
1020284849 7:6671467-6671489 GGGGGGTCAGCCCCCGCCCCCGG - Intergenic
1022106277 7:27199898-27199920 GTGGGGGAAGCCCCCGCCCCCGG + Exonic
1025202309 7:56969959-56969981 TCTGGGCAGGCCCCCGCCCCAGG + Intergenic
1025261752 7:57424903-57424925 GGAGAGGAAGCCCCTGCCCCTGG + Intergenic
1025615692 7:63114359-63114381 GGAGAGGAAGCCCCAGCCCCTGG - Intergenic
1032231246 7:130076299-130076321 GGTCCGCAAGCCCCAGGCCATGG - Intronic
1037916758 8:22777659-22777681 GGTGCCCCAGCCACCACCCCCGG - Intronic
1038026894 8:23598961-23598983 GGTGTGCAAGCCCCATCTCCCGG + Intergenic
1038155325 8:24983970-24983992 GATGCCAAAGCCCCCGCCCTCGG + Intergenic
1040850978 8:51899699-51899721 GGAGCACACGCCCCCGGCCCGGG - Intergenic
1043969625 8:86514832-86514854 GGTGCGCGAGCGCCAGGCCCAGG - Intronic
1044591352 8:93916959-93916981 GGAGCGCGAGCCCTCACCCCCGG - Exonic
1045432046 8:102123805-102123827 GGTGCCCCGGCCCCCGGCCCCGG + Intronic
1047931117 8:129728860-129728882 GGTCCACAAGAGCCCGCCCCAGG - Intergenic
1047950881 8:129933596-129933618 GGTGCGCGAGCCACCGCACCCGG - Intronic
1051641707 9:19230346-19230368 GGTGCTCAGGCCCCTCCCCCGGG - Intergenic
1053151908 9:35749054-35749076 GGCCCGCAAGGCACCGCCCCCGG + Exonic
1053435218 9:38069411-38069433 GGTGCGCCCACCCCGGCCCCGGG - Intergenic
1053906783 9:42851417-42851439 GGCGCCCAGGCACCCGCCCCAGG - Intergenic
1054368539 9:64368421-64368443 GGCGCCCAGGCACCCGCCCCAGG - Intergenic
1054528183 9:66154086-66154108 GGCGCCCAGGCACCCGCCCCAGG + Intergenic
1060220561 9:121762093-121762115 GGTACCTAAGCCCCCACCCCTGG + Intronic
1061263134 9:129490885-129490907 GGTGCCCCACACCCCGCCCCAGG + Intergenic
1062330914 9:136044595-136044617 AGTGCGGACGCCCCCGTCCCAGG + Intronic
1062547436 9:137070034-137070056 GGAGAGGAAGCCCCTGCCCCTGG - Exonic