ID: 1136631858

View in Genome Browser
Species Human (GRCh38)
Location 16:31493549-31493571
Sequence CTCAACCTCTCCCACTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1152
Summary {0: 1, 1: 0, 2: 2, 3: 62, 4: 1087}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136631858_1136631860 -3 Left 1136631858 16:31493549-31493571 CCTAGGCAGTGGGAGAGGTTGAG 0: 1
1: 0
2: 2
3: 62
4: 1087
Right 1136631860 16:31493569-31493591 GAGACACAGGACCCGAGACCAGG 0: 1
1: 0
2: 1
3: 11
4: 165
1136631858_1136631863 3 Left 1136631858 16:31493549-31493571 CCTAGGCAGTGGGAGAGGTTGAG 0: 1
1: 0
2: 2
3: 62
4: 1087
Right 1136631863 16:31493575-31493597 CAGGACCCGAGACCAGGGGCAGG 0: 1
1: 0
2: 0
3: 17
4: 247
1136631858_1136631864 4 Left 1136631858 16:31493549-31493571 CCTAGGCAGTGGGAGAGGTTGAG 0: 1
1: 0
2: 2
3: 62
4: 1087
Right 1136631864 16:31493576-31493598 AGGACCCGAGACCAGGGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 199
1136631858_1136631868 21 Left 1136631858 16:31493549-31493571 CCTAGGCAGTGGGAGAGGTTGAG 0: 1
1: 0
2: 2
3: 62
4: 1087
Right 1136631868 16:31493593-31493615 GCAGGGTCACCTGTCCACAGCGG 0: 1
1: 0
2: 3
3: 30
4: 243
1136631858_1136631861 -2 Left 1136631858 16:31493549-31493571 CCTAGGCAGTGGGAGAGGTTGAG 0: 1
1: 0
2: 2
3: 62
4: 1087
Right 1136631861 16:31493570-31493592 AGACACAGGACCCGAGACCAGGG 0: 1
1: 0
2: 1
3: 11
4: 164
1136631858_1136631862 -1 Left 1136631858 16:31493549-31493571 CCTAGGCAGTGGGAGAGGTTGAG 0: 1
1: 0
2: 2
3: 62
4: 1087
Right 1136631862 16:31493571-31493593 GACACAGGACCCGAGACCAGGGG 0: 1
1: 0
2: 0
3: 8
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136631858 Original CRISPR CTCAACCTCTCCCACTGCCT AGG (reversed) Intronic
900100963 1:961901-961923 CTCGACCCCTCCAACTGCCTGGG + Exonic
900153776 1:1195222-1195244 CTCAAGCGATCCCCCTGCCTTGG + Intronic
900463423 1:2812155-2812177 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
900664602 1:3806225-3806247 CTCCCCCTCTCTCTCTGCCTCGG - Intergenic
900672048 1:3860460-3860482 CTCAAGCTGTCCTCCTGCCTTGG + Intronic
901041014 1:6363613-6363635 CTCTCCCTCTCTCTCTGCCTTGG + Intronic
901211087 1:7526439-7526461 CTCAGCCTCTTCCACTGCAGGGG - Intronic
901330525 1:8404299-8404321 CTCAGCCTCTCCGAGTACCTGGG - Intronic
901353869 1:8625537-8625559 CTGAAGCTATCCCCCTGCCTCGG + Intronic
901396586 1:8986503-8986525 CTCAAGCGGTCCTACTGCCTCGG - Intergenic
901448265 1:9321003-9321025 CACAGCAACTCCCACTGCCTTGG - Intronic
901521853 1:9791465-9791487 CTCAAGCAATCCCCCTGCCTTGG + Intronic
901544610 1:9946421-9946443 CTCAACTCCTCCCGCTGCCAAGG - Intronic
901572324 1:10171510-10171532 CTCAAGCAATCCCCCTGCCTTGG - Intronic
901689246 1:10961708-10961730 CTCAACCGATCCACCTGCCTTGG - Intronic
902047268 1:13535024-13535046 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
902297865 1:15480827-15480849 CTCAACCCATCCTCCTGCCTTGG + Intronic
902308874 1:15565160-15565182 CTGACCCTTTCCCACTGGCTAGG + Intronic
902943765 1:19818976-19818998 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
902980461 1:20119124-20119146 CCCTACCTCTCCCACTGAATAGG - Intronic
903182922 1:21614109-21614131 CTCAGCCTCACCCACTCCCCTGG - Intronic
903413459 1:23166217-23166239 CTCTACTTTGCCCACTGCCTTGG - Intronic
903515815 1:23910192-23910214 CTCAAGCTATCCTCCTGCCTGGG + Intronic
903905122 1:26680168-26680190 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
903999060 1:27327838-27327860 CTCAAGCAATCCAACTGCCTTGG + Intronic
904024769 1:27495737-27495759 CTCAAGCGATCCCCCTGCCTTGG - Intergenic
904221789 1:28976585-28976607 CTCAAGCTATCCTCCTGCCTTGG + Intronic
904350924 1:29905971-29905993 CTCAAGCGATCCCTCTGCCTCGG + Intergenic
904517781 1:31070144-31070166 CTCAAGCAATCCTACTGCCTCGG + Intergenic
904577093 1:31511841-31511863 CTCACCCTCTCCCACCCCCCAGG - Intergenic
904743123 1:32694001-32694023 CTCAAGCTATCCGCCTGCCTTGG - Intronic
904821965 1:33251380-33251402 CTCCACCTCTGCCAATGCCAAGG + Intergenic
905100883 1:35521220-35521242 CTCAACCTCCCCCAGTTGCTGGG - Intronic
905277258 1:36826432-36826454 CTCAAACTATCCTCCTGCCTCGG - Intronic
905279684 1:36841200-36841222 GTCAGCCTCTTCCTCTGCCTGGG - Intronic
905493101 1:38360858-38360880 CTCAAGCTCTCACAATGACTTGG + Intergenic
906037589 1:42761650-42761672 CTCAAGCGATCCTACTGCCTTGG - Intronic
906127416 1:43435745-43435767 TTCAACCTCTCCCCCTCCCCTGG - Intronic
906157771 1:43623976-43623998 CTGCCCCTCTCCCACTACCTTGG + Intergenic
906412755 1:45592344-45592366 CTCAAGCAATCCCCCTGCCTTGG + Intronic
906637456 1:47418701-47418723 CTCAACCGATCCTCCTGCCTTGG - Intergenic
906995214 1:50786032-50786054 CTCAAGCAGTCCCCCTGCCTTGG - Intronic
907120252 1:52002104-52002126 CTCAAGCAATCCCCCTGCCTCGG - Intergenic
907654997 1:56333303-56333325 CTCAACCAATCCTCCTGCCTGGG - Intergenic
907923907 1:58938299-58938321 GTCAAGCTATCCCACTGTCTCGG + Intergenic
908011451 1:59782244-59782266 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
908222338 1:62019933-62019955 CTCAAGCCATCCTACTGCCTTGG - Intronic
908229014 1:62085579-62085601 CTCAAGCTATCCACCTGCCTCGG - Intronic
908367568 1:63441988-63442010 CTCAAGCAGTCCCTCTGCCTTGG - Intronic
908551918 1:65216932-65216954 CTCAAGTGATCCCACTGCCTCGG + Intronic
908579201 1:65496337-65496359 CTCAAGCCATCCCACCGCCTTGG - Intronic
908799623 1:67865885-67865907 CTCAAGCAATCCTACTGCCTCGG - Intergenic
909254214 1:73397881-73397903 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
909305768 1:74075005-74075027 CTCAATCTCTCTCACAGCATTGG - Intronic
909927570 1:81456469-81456491 CTCAAGCTGTCCTCCTGCCTTGG + Intronic
910148135 1:84106955-84106977 CTGAACCTCTCCCTCCTCCTGGG - Intronic
910186971 1:84554041-84554063 CTCAAGCACTCCTCCTGCCTTGG - Exonic
910390893 1:86742724-86742746 CTCAAGTGATCCCACTGCCTTGG - Intronic
910496451 1:87834407-87834429 CTCAAGTTATCCCCCTGCCTTGG - Intergenic
910760543 1:90727380-90727402 CTGAACCGCTCCCTCTCCCTGGG + Intergenic
911073491 1:93850557-93850579 CTCTCCCTCTCTCTCTGCCTCGG - Intergenic
911620585 1:100063403-100063425 CTCAAGCAATCCCCCTGCCTTGG - Intronic
911642556 1:100304514-100304536 CTCAAACTGTCCTGCTGCCTCGG + Intergenic
912248680 1:107988527-107988549 CTCAAGCACTCCACCTGCCTTGG + Intergenic
912296094 1:108472450-108472472 ATAAACTTTTCCCACTGCCTTGG + Intergenic
912371983 1:109180729-109180751 CTCAAGCACTCCTCCTGCCTCGG - Intronic
912499061 1:110109958-110109980 CTCCACCAGTCCCACCGCCTTGG - Intergenic
912794815 1:112686502-112686524 CTCAACTACTCACACTCCCTGGG + Intronic
912843265 1:113058044-113058066 CTCAGCCTCTCCCAGTAGCTGGG - Intergenic
914242561 1:145861654-145861676 CTCAACCTCTCCGAGTAGCTGGG - Intergenic
914252144 1:145930561-145930583 CTCAAACTATCCACCTGCCTCGG - Intergenic
914259463 1:145986711-145986733 CTCAAGCTATCCGCCTGCCTCGG - Intergenic
915198012 1:154204793-154204815 CTCAAGCAATCCCCCTGCCTCGG + Intronic
915234816 1:154472926-154472948 CTCAAGCCATCCCCCTGCCTTGG - Intronic
915297672 1:154932865-154932887 CTCAAGCACTCCTCCTGCCTTGG - Intronic
915494580 1:156272687-156272709 CTCAGCCTCTCCCAGTAGCTGGG + Intronic
916449022 1:164901940-164901962 CTCAAGCTATCCGCCTGCCTCGG + Intergenic
916522871 1:165580905-165580927 CTCAAACTATCCTCCTGCCTTGG - Intergenic
916585951 1:166150237-166150259 CCCAAACCCTCCCAGTGCCTTGG + Intronic
916938186 1:169652576-169652598 CTCAAGCTATCCCCCTGCCTCGG + Intergenic
917082838 1:171273748-171273770 CTCAAGCTATCCTCCTGCCTTGG + Intronic
917315235 1:173718159-173718181 CTCAAGCAGTCCCCCTGCCTAGG + Intronic
917328126 1:173854208-173854230 CTCAAGCACTCCTCCTGCCTCGG + Intronic
917765063 1:178206939-178206961 CTTAAGCAATCCCACTGCCTTGG - Intronic
917938902 1:179896607-179896629 CTCAACCTCTTCCACTGAGTAGG - Intronic
918053429 1:180995620-180995642 CTCAAGCGTTCCGACTGCCTTGG - Intronic
918066455 1:181105186-181105208 CTCGTCCTCTCCCGCAGCCTCGG + Intergenic
918718970 1:187828051-187828073 CTCAAGCCCTCCCCCTGCCTTGG - Intergenic
919705620 1:200672479-200672501 CTCAAGCTATCCACCTGCCTTGG + Intergenic
919728321 1:200897853-200897875 CTCAAGCTATCCTTCTGCCTTGG + Intronic
920103303 1:203532002-203532024 CTCAAGCTCTCCTTCTGTCTTGG + Intergenic
920175623 1:204099906-204099928 CTCAAGCTATCCTCCTGCCTTGG - Intronic
920278196 1:204824208-204824230 CTCCACATCTGCCACTGCTTTGG + Intergenic
920573383 1:207035418-207035440 CTCAAGCAATCCCCCTGCCTTGG - Intronic
920691368 1:208148963-208148985 CTCATCCTCTCCAAATGCTTAGG - Intronic
921974400 1:221186448-221186470 CTCAAGCACTCCTCCTGCCTTGG + Intergenic
922084055 1:222328583-222328605 CTCAACCACTCTCACTTCATTGG + Intergenic
922110211 1:222548540-222548562 CTCCATATCTCCCACCGCCTTGG - Intergenic
922113940 1:222590815-222590837 CTCAAACTTTCCGCCTGCCTCGG - Intergenic
922131062 1:222779190-222779212 CTCAAGCAATCCTACTGCCTTGG - Intergenic
922298049 1:224269317-224269339 CTCAACCAATCCTCCTGCCTTGG + Intronic
922500549 1:226094224-226094246 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
922502247 1:226105730-226105752 CTCAAGCCATCCCCCTGCCTTGG - Intergenic
922541501 1:226423714-226423736 CTCAAGCAATCCCCCTGCCTCGG - Intergenic
922881120 1:228981711-228981733 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
923001375 1:230008915-230008937 CTCAACCGATCCACCTGCCTTGG - Intergenic
923002577 1:230019896-230019918 CTTCACCTCTGCCACTGCCATGG + Intergenic
923094086 1:230761025-230761047 ATCAACCACTTCCACTCCCTGGG - Intronic
923240127 1:232076319-232076341 CTCAAGCTATCCTTCTGCCTAGG + Intergenic
923442240 1:234031641-234031663 CTCAACCCATCCCCCTGCCTTGG + Intronic
923689408 1:236177787-236177809 CTCAAGCTATCCACCTGCCTTGG + Intronic
923705232 1:236338528-236338550 CTCAAGCTGTCCTCCTGCCTTGG - Intergenic
923822717 1:237463605-237463627 CTCAAGTGATCCCACTGCCTTGG - Intronic
924114462 1:240731455-240731477 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
924209758 1:241752614-241752636 CTCAAGCTATCCTCCTGCCTTGG - Intronic
924328166 1:242916304-242916326 CTCAAGCTGTCCTCCTGCCTTGG - Intergenic
924803757 1:247346822-247346844 CTCAACCTGTACCACAGACTGGG + Intergenic
1062947660 10:1473613-1473635 CTCAAGCTATCCACCTGCCTTGG + Intronic
1063367727 10:5501138-5501160 CTCAGCCTCTCCCTCTGCTGTGG - Intergenic
1063473112 10:6304913-6304935 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
1063473129 10:6305093-6305115 CTCAAACTATCCTCCTGCCTTGG + Intergenic
1063473145 10:6305255-6305277 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
1063473162 10:6305412-6305434 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1063551637 10:7039438-7039460 CTCACTCTCTCCCACTCCCCAGG + Intergenic
1063603038 10:7499147-7499169 CTCAACCTATCCTCCTGCGTTGG - Intergenic
1063636136 10:7785014-7785036 CTCAAGCACTCCTCCTGCCTCGG - Intronic
1063969554 10:11372052-11372074 CTCAACTGATCCCCCTGCCTGGG + Intergenic
1064448604 10:15420777-15420799 CTCAACCTCCCCAACCTCCTTGG + Intergenic
1064529286 10:16290733-16290755 CTTGACCTCTCCCATTGCTTAGG - Intergenic
1064553612 10:16526305-16526327 CTCAAATTATCCAACTGCCTTGG + Intergenic
1064649195 10:17491016-17491038 CTCAACCAATCCTCCTGCCTCGG - Intergenic
1064725765 10:18278244-18278266 CTCAAGCTATCCTTCTGCCTTGG - Intronic
1064828876 10:19439295-19439317 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1065069003 10:22003223-22003245 CTCAACTTCTACCAGTTCCTCGG - Exonic
1065245427 10:23751259-23751281 CTCAAGCTCTCTGCCTGCCTCGG + Intronic
1065614056 10:27501978-27502000 CTCAAGCAATCCCCCTGCCTCGG - Intergenic
1066343294 10:34557401-34557423 CTCAAGCGATCCTACTGCCTTGG - Intronic
1066439306 10:35423239-35423261 CTCAAGCAATCCAACTGCCTCGG - Intronic
1066762337 10:38767489-38767511 CTCAGCCTCTCCAAGTGGCTGGG - Intergenic
1066959253 10:42204985-42205007 CTCAGCCTCTCCTAGTGGCTGGG + Intergenic
1067286028 10:44908288-44908310 TTCCACCTCCCTCACTGCCTTGG + Intergenic
1067314239 10:45146738-45146760 CTCAAGCTATCCACCTGCCTCGG - Intergenic
1068966655 10:62918553-62918575 CTCAAGCTCTCCCCCTCCCCGGG + Intronic
1068985196 10:63101705-63101727 CTCAACTGATCCCCCTGCCTTGG - Intergenic
1069384186 10:67869696-67869718 CTCAACCAGTCCTCCTGCCTTGG - Intergenic
1069940352 10:71951199-71951221 GTCTACCTCTCCTACTCCCTTGG - Intergenic
1069979222 10:72240670-72240692 CTCAAGCACTCCTCCTGCCTTGG - Intergenic
1070145421 10:73770376-73770398 CTCAACCTCTTCCTCTGGGTGGG + Exonic
1070240668 10:74677009-74677031 CTCAAGCTGTCCACCTGCCTTGG - Intronic
1070509357 10:77146465-77146487 CTCAACCTATCTGCCTGCCTTGG - Intronic
1070610852 10:77931481-77931503 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1070942917 10:80362487-80362509 CGCCACCTCTGCCAGTGCCTGGG - Exonic
1071090696 10:81914497-81914519 CTCAACCAATCCTGCTGCCTCGG - Intronic
1071318850 10:84431505-84431527 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1071482025 10:86071843-86071865 GACCACCTCTCCCACTGGCTGGG - Intronic
1072066631 10:91877894-91877916 CTCAAGCTTTCCTTCTGCCTTGG - Intergenic
1072118298 10:92384579-92384601 CTCAAGCTATCCACCTGCCTTGG + Intergenic
1072162739 10:92783617-92783639 CTCAAACTATCCTCCTGCCTTGG - Intergenic
1072327132 10:94309799-94309821 CTCAAGCTATCCTTCTGCCTTGG - Intronic
1072702428 10:97652532-97652554 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1072712326 10:97723996-97724018 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
1072931131 10:99663692-99663714 CTCAACCTATCCTCCTGCCTCGG + Intronic
1073088430 10:100911681-100911703 CTCAAGCTATCCACCTGCCTTGG + Intergenic
1073167903 10:101473829-101473851 CTCAAGCTATCCTCCTGCCTCGG + Intronic
1073198779 10:101717706-101717728 CTCAAGTTCTCCTCCTGCCTTGG + Intergenic
1073433702 10:103503180-103503202 CTCACCACCTCCCACTTCCTGGG - Intronic
1073520345 10:104122293-104122315 CTCAACCTCACCTTATGCCTGGG + Intronic
1073747634 10:106487649-106487671 CTCAAGCTATCCCACCACCTTGG - Intergenic
1074171223 10:110939451-110939473 CTCAACCAATCCCCCTACCTTGG + Intronic
1074224577 10:111471973-111471995 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1074371069 10:112901221-112901243 CTCAAGCGCTCCATCTGCCTTGG + Intergenic
1074511220 10:114114020-114114042 CTCAAGCTATCCACCTGCCTCGG - Intergenic
1075016499 10:118913676-118913698 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
1075134821 10:119774565-119774587 CTCAAGCAATCCCTCTGCCTTGG + Intronic
1075159368 10:120009955-120009977 CTCTTCCTCTACCGCTGCCTTGG + Intergenic
1075172909 10:120132339-120132361 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1075323550 10:121511626-121511648 CTCACCCACTCCCACTCCTTTGG - Intronic
1075837305 10:125465623-125465645 CTCATCCACCACCACTGCCTGGG + Intergenic
1076024603 10:127101108-127101130 CCCAACCTCTGCCCCTGCCTTGG - Intronic
1076120794 10:127935202-127935224 CTCTGCCCCTCCCACTGCCCAGG + Intronic
1076767719 10:132645777-132645799 CTCCACCGCCCCCACAGCCTGGG - Intronic
1077108777 11:853103-853125 CCCAACCCCTCCCAGTGCCCTGG - Intronic
1077608988 11:3632454-3632476 CTCAAGCTATCCTTCTGCCTCGG + Intergenic
1077620241 11:3715364-3715386 CTCAAGCTATCCACCTGCCTCGG + Intronic
1077650681 11:3969249-3969271 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1077653001 11:3991402-3991424 CTCAAGCTCTCCTCCCGCCTTGG + Intronic
1077896025 11:6454143-6454165 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1077982462 11:7314405-7314427 CTCAACCACTCCCACTGGTAGGG - Intronic
1078037625 11:7823960-7823982 CTCAAGTGATCCCACTGCCTTGG + Intergenic
1078135740 11:8650137-8650159 CTCAAGCACTCCTCCTGCCTTGG - Intronic
1078594180 11:12672941-12672963 CTCAAGCTGTCCTCCTGCCTCGG - Intergenic
1078612638 11:12834848-12834870 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1078649072 11:13170485-13170507 CTCAAGCGATCCCCCTGCCTTGG - Intergenic
1078788875 11:14523814-14523836 CTCAAGCTATCCTCCTGCCTGGG + Intronic
1078809501 11:14743821-14743843 CTCAACCCCTTGCACTTCCTGGG + Intronic
1078988124 11:16614154-16614176 CCCACCCTCTGCCACTGCCCTGG - Intronic
1079075149 11:17380721-17380743 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1079231388 11:18651952-18651974 CTCAAGCTATCCCCCTGCCTTGG + Intergenic
1079716304 11:23750624-23750646 CTCAACCTATCCACCTGACTTGG - Intergenic
1080168257 11:29267045-29267067 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1080634437 11:34111292-34111314 GACAAACTCACCCACTGCCTTGG + Intronic
1081638847 11:44739183-44739205 CTCCACCTCCCTCACAGCCTAGG - Intronic
1081787116 11:45755628-45755650 CTCTGCCTCTGCCTCTGCCTGGG - Intergenic
1081900698 11:46625495-46625517 CTCAAGCTATCCTCCTGCCTCGG + Intronic
1081931187 11:46872508-46872530 CTCAAGCAATCCTACTGCCTTGG - Intronic
1082017102 11:47498171-47498193 CTCAAGCTATCCTGCTGCCTCGG - Intronic
1082102516 11:48184708-48184730 CCCTTCCTCTTCCACTGCCTGGG - Intergenic
1083191582 11:61056122-61056144 CTCAAGCTATCCACCTGCCTCGG - Intergenic
1083565695 11:63713542-63713564 CTCAAGCTGTCTCCCTGCCTTGG + Intronic
1084150928 11:67287667-67287689 CTCTTCCTCTCCCACTGCGGAGG - Intergenic
1084269264 11:68020466-68020488 CTCAACCAGTCCTCCTGCCTTGG + Intronic
1084457802 11:69278363-69278385 CTCACCCTCCCCCACAGCCCCGG - Intergenic
1084470795 11:69357792-69357814 GTCACCCTGTCCCACTGCCCTGG - Intronic
1084779956 11:71401534-71401556 CTCAAGCTGTCCACCTGCCTCGG + Intergenic
1084851864 11:71948280-71948302 CTCAAGTTATCCAACTGCCTCGG - Intronic
1085028623 11:73256147-73256169 CTCAAGCGATCCCCCTGCCTTGG + Intergenic
1085083822 11:73653719-73653741 CTTAACCTCTCTCAGAGCCTTGG - Intronic
1085111715 11:73895871-73895893 CTCAAGCTATCCTTCTGCCTTGG - Intronic
1085330725 11:75648258-75648280 CTCAAGCTATCCACCTGCCTTGG - Intronic
1086094635 11:83037998-83038020 TTCACCCTCTCCCACTCCCAAGG - Intronic
1086901757 11:92375372-92375394 CTCAAGCTCTCCTCCTGCCTTGG + Intronic
1087097260 11:94331258-94331280 CTCACCTTCTCTCCCTGCCTTGG - Intergenic
1087476119 11:98637307-98637329 CTCAAGCTGTCCTCCTGCCTTGG - Intergenic
1088238136 11:107747091-107747113 CTCAAGCCATCCCTCTGCCTTGG - Intergenic
1089069538 11:115688752-115688774 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
1089105620 11:116001041-116001063 ATCAACCTCTCCCACTTTCAAGG - Intergenic
1089262277 11:117231641-117231663 CTCAACCTCTCCCAACGGCTAGG + Intronic
1089298066 11:117481535-117481557 CTCAGCCCCTCCCACTCCCCTGG - Intronic
1089543077 11:119202496-119202518 CTCAAGCTATCCTCCTGCCTGGG - Intergenic
1089570785 11:119407728-119407750 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1090212646 11:124933402-124933424 CTCAAGCAATCCAACTGCCTAGG + Intronic
1090438866 11:126709852-126709874 CTCAGCCTCTCCAGCTCCCTTGG - Intronic
1090624704 11:128596233-128596255 CTCAAGCAATCCCCCTGCCTCGG - Intergenic
1090956188 11:131514823-131514845 CTCAAACGATCCTACTGCCTTGG + Intronic
1090983595 11:131746116-131746138 GTCATCCTCTCCTACTGCCATGG + Intronic
1091234797 11:134014104-134014126 CTCAAGCGATCCCCCTGCCTTGG - Intergenic
1092210460 12:6643016-6643038 CTCAACCAATCCTCCTGCCTCGG - Intronic
1092302021 12:7260394-7260416 CTCAAACAATCCTACTGCCTTGG - Intergenic
1092584752 12:9887816-9887838 CTCAAGCGCTCCACCTGCCTTGG - Intronic
1093052308 12:14517379-14517401 CTCAAGCGCTCCTCCTGCCTTGG + Intronic
1093682509 12:22018601-22018623 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1094580285 12:31728437-31728459 CGTAACCTCTCCCTGTGCCTAGG - Intronic
1094653291 12:32398553-32398575 CTCAAGCAATCCTACTGCCTTGG - Intergenic
1094657719 12:32436882-32436904 CTCAAGCTATCCACCTGCCTTGG - Intronic
1095701540 12:45195691-45195713 CTCAAGCTATCCGCCTGCCTTGG - Intergenic
1095767313 12:45911271-45911293 CTCAAGCAATCCTACTGCCTTGG + Intergenic
1095910841 12:47424821-47424843 ATCACCCACACCCACTGCCTAGG + Intergenic
1096155809 12:49340992-49341014 CTCTCACTCTTCCACTGCCTTGG - Intergenic
1096306573 12:50482984-50483006 CTCAAGCGATCCTACTGCCTTGG + Intergenic
1096380444 12:51153142-51153164 CTCAAGCCATCCCCCTGCCTTGG - Intronic
1096390735 12:51226990-51227012 CTCAAGCTATCCACCTGCCTTGG + Intergenic
1096867644 12:54574735-54574757 CTCAAGCTATCCACCTGCCTCGG - Intronic
1097027859 12:56071343-56071365 TTCAAGCAATCCCACTGCCTTGG - Intergenic
1097293982 12:57943444-57943466 CTCAAGCAATCCCCCTGCCTTGG - Intronic
1097572659 12:61354619-61354641 CTCAAGCAATCCCTCTGCCTTGG - Intergenic
1097849465 12:64397352-64397374 CTCAAGCTATCCACCTGCCTTGG - Intergenic
1097864499 12:64548421-64548443 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1098318327 12:69215211-69215233 CTCAAGCTATCCACCTGCCTTGG - Intergenic
1098446452 12:70570580-70570602 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1099139736 12:78957233-78957255 CTCAAGCTGTCCTCCTGCCTGGG - Intronic
1099465707 12:82985283-82985305 CTCAAGCTATCCGCCTGCCTTGG + Intronic
1099798087 12:87422923-87422945 CTCAACGTCTACCACTTCCCAGG + Intergenic
1099962864 12:89413302-89413324 CTCAAGCAATCCCCCTGCCTCGG + Intergenic
1100274502 12:93059402-93059424 CTCAATCTCAGCCATTGCCTTGG - Intergenic
1100290161 12:93206065-93206087 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1100291875 12:93223298-93223320 CTCAAGCTGTCCTCCTGCCTCGG + Intergenic
1100481198 12:94981194-94981216 CTCAAGCTATCCACCTGCCTTGG - Intronic
1100608202 12:96169328-96169350 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1100690660 12:97035363-97035385 CTCTACCACTCCCACTACATTGG - Intergenic
1100837425 12:98579795-98579817 CTCAAGCAATCCCCCTGCCTCGG + Intergenic
1101117076 12:101542407-101542429 CTCAACTGATCCCCCTGCCTCGG + Intergenic
1101331013 12:103758002-103758024 CTCAAACTCTCCCACGGCGCAGG + Intronic
1101886885 12:108671994-108672016 CTCAACCCGTCCACCTGCCTCGG + Intronic
1101964692 12:109274482-109274504 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1102118367 12:110420870-110420892 CTCAAGCTGTCCTCCTGCCTTGG + Intergenic
1102149059 12:110676213-110676235 CCCACCCTCTGCCACTGCCCTGG + Intronic
1102210549 12:111123767-111123789 CTCAAGCAATCCCCCTGCCTCGG + Intronic
1102420268 12:112797920-112797942 CTCAAGCTATCCTCCTGCCTCGG + Intronic
1102876418 12:116452722-116452744 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1103119846 12:118372013-118372035 CTCCTCTTCTCCCACTGTCTTGG + Intronic
1103415305 12:120738959-120738981 CCCAACCTCTCCCCGTCCCTGGG - Intronic
1103455986 12:121065831-121065853 CTCAAGCAGTCCTACTGCCTTGG + Intergenic
1103515337 12:121504293-121504315 CTCAACCAGTCCTCCTGCCTCGG + Intronic
1103538864 12:121652465-121652487 CTCAACTTATCCGCCTGCCTTGG + Intronic
1103589743 12:121982996-121983018 CTCAAGCAATCCCTCTGCCTTGG - Intronic
1104427160 12:128687334-128687356 CTCAACATCTTACAGTGCCTAGG - Intronic
1104849040 12:131862405-131862427 CTCAAGCACTCCTCCTGCCTTGG + Intergenic
1105242461 13:18620302-18620324 CTGAACCTCCCCCAGGGCCTTGG + Intergenic
1105384572 13:19917823-19917845 CTCAAGCTATCCACCTGCCTCGG - Intergenic
1105807556 13:23964754-23964776 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1106099667 13:26683236-26683258 CTCAAGCAATCCAACTGCCTTGG - Intronic
1106210168 13:27634906-27634928 CTCAACCTATCCACCTGCCTTGG + Intronic
1106275441 13:28201275-28201297 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1106320984 13:28638596-28638618 CTCAAGCAGTCCCCCTGCCTTGG + Intergenic
1106743890 13:32679151-32679173 CTCAAGCTGTCCTTCTGCCTTGG + Intronic
1106936139 13:34722726-34722748 ATCAATCTCTCACACTCCCTTGG + Intergenic
1107032235 13:35864883-35864905 CTCAACCAGTCCTCCTGCCTAGG + Intronic
1107748681 13:43541263-43541285 CTCAACCAATCCCCCTGCCCTGG - Intronic
1108627231 13:52242510-52242532 CTCACTCTCTCCCATTACCTTGG - Intergenic
1108635584 13:52331425-52331447 CTCAAGCAATCCTACTGCCTCGG - Intergenic
1108658836 13:52563952-52563974 CTCACTCTCTCCCATTGCCTTGG + Intergenic
1109341135 13:61060518-61060540 CTCAAGCCATCCCCCTGCCTTGG + Intergenic
1110770425 13:79337206-79337228 CTCGCCCTCGCCCCCTGCCTCGG + Exonic
1110846727 13:80197967-80197989 CTCAAGCACTCCTCCTGCCTTGG + Intergenic
1112012584 13:95304323-95304345 CTCAACCCCTCCAAGTACCTGGG + Intergenic
1112028597 13:95436416-95436438 CTCAAGCAATCCTACTGCCTTGG + Intronic
1112030427 13:95451527-95451549 CTCAAGCTATCCTCCTGCCTCGG + Intronic
1112241802 13:97689094-97689116 CTCAACCGATCCTCCTGCCTTGG - Intergenic
1112350396 13:98628395-98628417 CTCAAGCGATCCCTCTGCCTTGG + Intergenic
1112534882 13:100243127-100243149 CTCAAGTGCTCCCCCTGCCTTGG + Intronic
1113152471 13:107280023-107280045 CTCAACCGATCCTCCTGCCTTGG + Intronic
1113742958 13:112724055-112724077 CTCACCAGCGCCCACTGCCTGGG + Intronic
1114280168 14:21186966-21186988 CTCAAGCAATCCTACTGCCTTGG - Intergenic
1114376447 14:22151826-22151848 CTCAACCTATCTGTCTGCCTTGG + Intergenic
1114481939 14:23041495-23041517 CTCAAGCCATCCCCCTGCCTTGG + Intergenic
1114562100 14:23600672-23600694 CTCTCCCTCTCTCACTGCATGGG + Intergenic
1114638178 14:24200662-24200684 CTCAGCCTCTCCAAGTGGCTGGG + Intronic
1114658289 14:24329217-24329239 CTCATCCTCCTCCTCTGCCTGGG + Exonic
1114950998 14:27753303-27753325 CTCAGCCTCTCCCACTAGCTGGG - Intergenic
1115209887 14:30956417-30956439 CTCAAGCAGTCCTACTGCCTTGG - Intronic
1116554475 14:46286053-46286075 CTCAAGCACTCCTCCTGCCTTGG - Intergenic
1117410205 14:55443484-55443506 CTCAAGCAATCCTACTGCCTTGG - Intronic
1117474641 14:56081595-56081617 CTCACTCTCTTCCACTGACTGGG - Intergenic
1117994886 14:61469168-61469190 CTCAAGCAATCCTACTGCCTTGG + Intronic
1118375902 14:65176781-65176803 CTCAACTCCTCCCTCTGCCATGG - Intergenic
1118610334 14:67534343-67534365 ATCAAGCTCTCCTCCTGCCTTGG - Intronic
1119059116 14:71457013-71457035 CTCAAGCAATCCTACTGCCTTGG + Intronic
1119398225 14:74344295-74344317 CTCAGCTTCTCCAACTGGCTGGG - Intronic
1119426195 14:74535925-74535947 CTGAACCTCACTCACTGCCAAGG - Exonic
1119539175 14:75427827-75427849 CTTAACCTCCCCCGCCGCCTTGG - Intronic
1119801925 14:77453261-77453283 CTCAACATCTATCCCTGCCTAGG + Intronic
1119819541 14:77602805-77602827 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1119843736 14:77812947-77812969 CTCAATCTCTCCCAACTCCTGGG - Intronic
1119847076 14:77838629-77838651 CTCAAGCTATCCACCTGCCTTGG + Intronic
1120926105 14:89799020-89799042 CTCAAGCCATCCCCCTGCCTCGG + Intronic
1120973119 14:90226026-90226048 CTCAAGCAATCCCCCTGCCTCGG - Intergenic
1121287444 14:92747560-92747582 CTCAACCTCTCCCACAAGTTAGG + Intronic
1121411255 14:93749807-93749829 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1121495310 14:94388127-94388149 CACCACCTCTCCTACTGCTTGGG - Intronic
1122495143 14:102148308-102148330 CTCAACCAATCCTCCTGCCTCGG - Intronic
1122497312 14:102167452-102167474 CTCAAGCTGTCCTCCTGCCTTGG + Intronic
1122640444 14:103156264-103156286 CTCAGTCGCTCCCACTGCATGGG + Intergenic
1122876423 14:104668081-104668103 CTCAAGCGCTCCACCTGCCTCGG - Intergenic
1122962283 14:105100579-105100601 CTCAAGCAGTCCCCCTGCCTAGG + Intergenic
1122978350 14:105180230-105180252 CTCAACCGATCCTCCTGCCTTGG - Intronic
1123488837 15:20764289-20764311 CTGAACCTCCCCCAGGGCCTTGG - Intergenic
1123545336 15:21333376-21333398 CTGAACCTCCCCCAGGGCCTTGG - Intergenic
1123633775 15:22281669-22281691 CTGAAGCTATCCCCCTGCCTCGG - Intergenic
1124018593 15:25899670-25899692 CTCAAACTATCCTTCTGCCTTGG + Intergenic
1124135878 15:27035955-27035977 CTTGACTTCTCCCACTGTCTTGG - Intronic
1124433086 15:29623809-29623831 CTCACCCTCTCCCTCCTCCTGGG + Intergenic
1124952956 15:34340322-34340344 CTCAAGCTGTCCTCCTGCCTTGG - Intergenic
1124974620 15:34520991-34521013 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1125067683 15:35509980-35510002 CTCAAGCAGTCCCCCTGCCTTGG - Intronic
1125151897 15:36542061-36542083 CACATGCTCTCCCACTGCCTGGG - Intergenic
1125701604 15:41690619-41690641 CTCAAGCTATCCTACTGCCTTGG - Intronic
1125781044 15:42268432-42268454 CTCAAGCGATCCCCCTGCCTTGG - Intronic
1126404781 15:48312673-48312695 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
1126578525 15:50220967-50220989 CTCAAGCTATCCTCCTGCCTCGG - Intronic
1126776822 15:52107562-52107584 CTCAAGTGATCCCACTGCCTTGG + Intergenic
1127233162 15:57018672-57018694 CTCAAGCACTCCACCTGCCTTGG + Intronic
1127395457 15:58541032-58541054 CTCAAGCAATCCCCCTGCCTTGG + Intronic
1127565031 15:60179038-60179060 TTCAACCAATCCCCCTGCCTTGG + Intergenic
1127786783 15:62362568-62362590 CTCAACCTACCCTCCTGCCTTGG + Intergenic
1128046171 15:64619231-64619253 CTCAAGCACTCCTCCTGCCTTGG + Intronic
1128405536 15:67333821-67333843 CTCAAGCCATCCTACTGCCTTGG - Intronic
1128937861 15:71763475-71763497 CTCAACCAATCCTCCTGCCTCGG - Intronic
1128960749 15:72002019-72002041 CTCAAGCAGTCCTACTGCCTTGG - Intronic
1129002706 15:72347464-72347486 CTCAAGCAATCCCCCTGCCTTGG + Intronic
1129315012 15:74736907-74736929 CTCAAGCTATCCTCCTGCCTAGG + Intergenic
1129594104 15:76946220-76946242 CTCAAGCTGTCCTCCTGCCTTGG - Intronic
1129600630 15:76996283-76996305 CTTTACCTCTACCACTGGCTGGG - Intronic
1129703293 15:77780353-77780375 CCCAGCCTCTCCCCATGCCTAGG - Intronic
1130450714 15:84049082-84049104 CTCAAGCAATCCAACTGCCTCGG - Intergenic
1131253477 15:90846022-90846044 CTCAACCGATCCTCCTGCCTCGG + Intergenic
1131843825 15:96467910-96467932 GTCAAACCCTCCCTCTGCCTTGG + Intergenic
1131893638 15:97002174-97002196 CTCAAACAATCCTACTGCCTTGG - Intergenic
1202953681 15_KI270727v1_random:60647-60669 CTGAACCTCCCCCAGGGCCTTGG - Intergenic
1132571417 16:646014-646036 GCCAACCTCTCCCACTTCCAGGG - Intronic
1132672875 16:1108866-1108888 CTCACCCCCTCCCACAGCCTCGG - Intergenic
1132842017 16:1982684-1982706 CTCAAGCAATCCCCCTGCCTCGG - Exonic
1133008043 16:2895496-2895518 CTCAACCTCTCCGAGTAGCTGGG - Intronic
1133070715 16:3245051-3245073 CTCAAGCGATCCCACTGCCCCGG - Intronic
1133163019 16:3924555-3924577 CTCAGCCTCTCCGAGTGGCTGGG - Intergenic
1133252129 16:4489690-4489712 CTCAAGCTATCCACCTGCCTTGG + Intronic
1133549012 16:6835635-6835657 CTCAGCCTCTCCCAGTAGCTGGG - Intronic
1133739717 16:8641860-8641882 TTCAGCCTCACCCGCTGCCTTGG - Intronic
1133795505 16:9043074-9043096 CGCCTCCTCTCCCCCTGCCTGGG + Intergenic
1134016436 16:10891736-10891758 CTCCACCTCTCCCAGCCCCTTGG - Intronic
1134133575 16:11665926-11665948 CTCAAGCCATCCCCCTGCCTTGG + Intergenic
1134145050 16:11754055-11754077 CTCAAGCACTCCTCCTGCCTCGG - Intronic
1134489057 16:14682064-14682086 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1134582898 16:15386551-15386573 CTCAACCGATCCTCCTGCCTTGG - Intergenic
1134586020 16:15411718-15411740 CTCAACCGATCCACCTGCCTTGG - Intronic
1134648186 16:15887859-15887881 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1134793209 16:17009965-17009987 CTCAAGCTATCCACCTGCCTTGG - Intergenic
1135314230 16:21430616-21430638 CTCAACCGATCCGCCTGCCTTGG - Intronic
1135338378 16:21624491-21624513 CTCAAGCGATCCGACTGCCTCGG - Intronic
1135341609 16:21653302-21653324 CTCAAGCGATCCCCCTGCCTTGG + Intronic
1135367153 16:21862894-21862916 CTCAACCGATCCGCCTGCCTTGG - Intronic
1135444661 16:22508266-22508288 CTCAACCGATCCGCCTGCCTTGG + Intronic
1135578987 16:23609196-23609218 CTCAAGCTATCCTACTGCCTCGG - Intronic
1135682259 16:24467885-24467907 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1135731468 16:24898441-24898463 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1136002288 16:27303886-27303908 CTCCTCCTCTGCCACTTCCTGGG + Intergenic
1136184186 16:28575909-28575931 CTCAACCAATCCTCCTGCCTTGG - Intronic
1136193389 16:28632809-28632831 CTCAACCGATCCACCTGCCTTGG + Intergenic
1136310898 16:29409324-29409346 CTCAACCGATCCACCTGCCTTGG - Intergenic
1136324342 16:29511101-29511123 CTCAACCGATCCGCCTGCCTTGG - Intergenic
1136370230 16:29831481-29831503 CCCCACCCCTCCCACTGCCCTGG - Intronic
1136439027 16:30251083-30251105 CTCAACCGATCCGCCTGCCTTGG - Intronic
1136449854 16:30347729-30347751 CTCAGCCTGACCCCCTGCCTGGG + Intergenic
1136631858 16:31493549-31493571 CTCAACCTCTCCCACTGCCTAGG - Intronic
1137278489 16:46954075-46954097 CTCAAGCTGTCCTTCTGCCTGGG + Intergenic
1137283655 16:46999184-46999206 CTCAAGTGCTCCCCCTGCCTTGG - Intergenic
1137436538 16:48458853-48458875 CTCAAGCGATCCCTCTGCCTTGG + Intergenic
1137618087 16:49858467-49858489 CTCTACCTCTGAGACTGCCTAGG - Intergenic
1137669239 16:50269733-50269755 TCCTACCTCTCCCACTGCCCAGG + Intronic
1137670990 16:50279103-50279125 CTCAAGCTATCCACCTGCCTTGG + Intronic
1138324092 16:56147269-56147291 CTCAAACAATCCCCCTGCCTCGG - Intergenic
1138433307 16:56983236-56983258 CTCAGCATCTCCCACTACCCAGG + Intronic
1138502239 16:57454420-57454442 CTCAAGCAATCCCTCTGCCTTGG - Intronic
1138610312 16:58118244-58118266 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1139150273 16:64373617-64373639 CTCAAGCTCTCCTCCTGCCTTGG - Intergenic
1139250093 16:65487051-65487073 CTCAGCCTCTCCCAGTAGCTGGG - Intergenic
1139300546 16:65941958-65941980 CTCAAGCTGTCCTTCTGCCTTGG - Intergenic
1139338320 16:66249394-66249416 CTCTACCTCTCCCACAGCACAGG + Intergenic
1139667630 16:68468870-68468892 CTCCACCTCTCCACCTCCCTGGG - Intergenic
1139722635 16:68869248-68869270 CTCAAACTATCCACCTGCCTTGG - Intronic
1139739404 16:69022468-69022490 CTCAAGCTATCCATCTGCCTTGG - Intronic
1139814963 16:69661987-69662009 CTCAAGCAATCCCCCTGCCTTGG - Intronic
1139822299 16:69730174-69730196 CTCAAGCGATCCCCCTGCCTTGG - Intergenic
1139858575 16:70001703-70001725 CTCAACCAATCCTCCTGCCTTGG - Intergenic
1139929545 16:70514945-70514967 CTCAAGCTATCCGCCTGCCTTGG + Intronic
1140073160 16:71670783-71670805 CTCCTCCACTCCCACTGCCCTGG - Intronic
1140345396 16:74208368-74208390 CTCAAACAGTCCCCCTGCCTTGG - Intergenic
1140380448 16:74482223-74482245 CTCAAGCTATCCCCCTGCCTAGG + Intronic
1140414663 16:74765785-74765807 CTCAAGCTCTCTTTCTGCCTTGG + Intronic
1140525478 16:75619287-75619309 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1140732496 16:77869439-77869461 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1140757759 16:78083806-78083828 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
1140824585 16:78693997-78694019 CTCAACCGATCCACCTGCCTCGG - Intronic
1140919620 16:79525251-79525273 CTCTGCCTCCCCCAATGCCTGGG + Intergenic
1140944436 16:79754726-79754748 CTGGTCCTCTCCCACTTCCTGGG - Intergenic
1141010668 16:80395342-80395364 CTCAAGCTGTCCTCCTGCCTTGG - Intergenic
1141053888 16:80798274-80798296 CTCAAGCTATCCACCTGCCTTGG + Intronic
1141345939 16:83245968-83245990 CTCAAGCTATCCACCTGCCTTGG + Intronic
1141551866 16:84811618-84811640 CTATACCAGTCCCACTGCCTAGG - Intergenic
1141583320 16:85015615-85015637 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1141628198 16:85272556-85272578 CTCCACCCCTCCCACTGCCTGGG - Intergenic
1141825820 16:86479752-86479774 AGGAACCTCTGCCACTGCCTCGG - Intergenic
1142191390 16:88719802-88719824 CTCAACCTCTTCCTCTTCCAGGG - Exonic
1142425819 16:90001775-90001797 GTCAGCCTCAACCACTGCCTTGG + Intergenic
1142707350 17:1704329-1704351 CTCAACCACTCCTCCTACCTCGG + Exonic
1142759841 17:2035848-2035870 CCCTACCTCTCCCAGTTCCTCGG - Intronic
1142810081 17:2391869-2391891 CTCAAGCGCTCTTACTGCCTTGG + Intronic
1142865349 17:2787487-2787509 CTCAAGCAATCCCCCTGCCTTGG + Intronic
1143052174 17:4135240-4135262 CTCAAGCAATCCTACTGCCTTGG - Intronic
1143767786 17:9149040-9149062 ACCAGCCTCTCCCACTGCCCTGG + Intronic
1144047108 17:11464148-11464170 CTCAAACTGTCCTCCTGCCTCGG + Intronic
1144075778 17:11718108-11718130 CTCAAGCTATCCATCTGCCTTGG + Intronic
1144736031 17:17555899-17555921 CTCCAGGTCTCCCTCTGCCTGGG + Intronic
1144766201 17:17734074-17734096 CTCAATCTCTCCCCCTGTCCTGG - Intronic
1145093743 17:20007861-20007883 CTCAAGCACTCCTCCTGCCTCGG + Intergenic
1145109998 17:20154362-20154384 CTCACCCTCTCTCACTCCCTGGG - Intronic
1145127526 17:20314539-20314561 CTCAAACGATCCTACTGCCTTGG - Exonic
1145285772 17:21505266-21505288 CTGAACCTTTCTCACTGCCTTGG + Intergenic
1145391824 17:22461034-22461056 CTGAACCTTTCTCACTGCCTTGG - Intergenic
1145866088 17:28242564-28242586 CTCAAACTATCCTCCTGCCTCGG - Intergenic
1145885108 17:28376701-28376723 CTCAAGCAATCCTACTGCCTTGG + Intronic
1146124077 17:30218337-30218359 CTCCATCTCACCCACTGCCCAGG - Exonic
1146240398 17:31217536-31217558 CTCAAGCACTCCGCCTGCCTTGG + Intronic
1146278640 17:31531072-31531094 CTGAGCCTCACCCTCTGCCTGGG + Intronic
1146440132 17:32886827-32886849 CTCAACCAATCCTCCTGCCTTGG + Intergenic
1146697892 17:34925351-34925373 CTCAAGCAGTCCCCCTGCCTTGG - Intergenic
1146779876 17:35660212-35660234 CTCAAGCAATCCCCCTGCCTTGG + Intronic
1146832126 17:36079062-36079084 CTCAAGCTATCCACCTGCCTTGG + Intergenic
1146846587 17:36185107-36185129 CTCAAGCTATCCACCTGCCTTGG + Intronic
1147399136 17:40168821-40168843 CTCAACCGATCCACCTGCCTCGG + Intronic
1147408687 17:40233069-40233091 CTGAATCTCTGCCACAGCCTGGG - Intronic
1147734048 17:42623283-42623305 CTCAAGCAATCCCACTGCCTCGG - Intergenic
1147802026 17:43098739-43098761 CTCAACCAATCCTTCTGCCTCGG + Intronic
1147933262 17:43995919-43995941 CTCAAGCGATCCAACTGCCTTGG - Intronic
1147947677 17:44089278-44089300 CTCAAGCCATCCCCCTGCCTTGG - Intronic
1148116634 17:45179210-45179232 CTCAAGCGATCCCTCTGCCTCGG - Intergenic
1148172343 17:45532913-45532935 CTCAAGCTCTCCTTCTGCTTTGG - Intergenic
1148200551 17:45747354-45747376 CTCAACCAATCCTCCTGCCTCGG + Intergenic
1148276924 17:46312539-46312561 CTCAAGCTCTCCTTCTGCTTTGG + Intronic
1148339047 17:46862539-46862561 CACAACCTCTCGCAGTGACTTGG - Intronic
1148363579 17:47034650-47034672 CTCAAGCTCTCCTTCTGCTTTGG + Intronic
1148395700 17:47306509-47306531 CTCAAGCTGTCCTCCTGCCTCGG + Intronic
1148717563 17:49726741-49726763 CTCAAGCAATCCTACTGCCTTGG - Intronic
1148846883 17:50534679-50534701 CTCCACCTCGCCCACTCCCACGG + Intronic
1149497375 17:57127891-57127913 CTAAATCTCTCCCAGTGCCCAGG - Intergenic
1149702000 17:58662990-58663012 CTCAGCCTCTCCGAGTGGCTGGG - Intronic
1149946355 17:60931837-60931859 CTCAAGCTATCCACCTGCCTTGG - Intronic
1150002231 17:61448428-61448450 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1150169649 17:62979810-62979832 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
1150242905 17:63649639-63649661 CTCAAGCTATCCACCTGCCTTGG + Intronic
1150333926 17:64316433-64316455 CTCAAGCAATCCTACTGCCTCGG - Intergenic
1150370453 17:64633035-64633057 CTCAAGCTATCTCCCTGCCTTGG - Intronic
1150403550 17:64879829-64879851 CTCAAGCTCTCCTTCTGCTTTGG - Intronic
1150558315 17:66273668-66273690 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
1150570371 17:66381173-66381195 CTCAAGCAGTCCCCCTGCCTCGG + Intronic
1150761892 17:67969727-67969749 CTCAAGCTATCCACCTGCCTTGG - Intronic
1151263514 17:72935961-72935983 CTCAAGCGATCCCCCTGCCTTGG - Intronic
1151343409 17:73486373-73486395 CTCAAGCCGTCCCCCTGCCTCGG - Intronic
1151541677 17:74767872-74767894 CTGAACCGCTCCCTCTCCCTGGG - Intronic
1151912834 17:77095370-77095392 CTCAGCTTCTGTCACTGCCTTGG - Intronic
1152388165 17:79987478-79987500 CTCAAGCGCTCCTCCTGCCTCGG + Intronic
1152483982 17:80577510-80577532 CTCAAGCAGTCCCCCTGCCTCGG + Intronic
1152768419 17:82153168-82153190 CCCTTCCTCTCCCTCTGCCTTGG - Intronic
1152774087 17:82189031-82189053 CTCAAGCTATCCACCTGCCTCGG - Intronic
1153098372 18:1435735-1435757 CTCATCCTTTCCCACTCACTCGG + Intergenic
1153377466 18:4396762-4396784 CTCACCCTCTCCATCTGTCTGGG - Intronic
1153416855 18:4855323-4855345 CTCAAGCTGTCCTCCTGCCTTGG + Intergenic
1153547698 18:6225524-6225546 CTCAACCTATCCACCTGCCTTGG - Intronic
1153601565 18:6785675-6785697 CTCAACTGCACCCACTTCCTTGG - Intronic
1153758704 18:8309765-8309787 CTCAAGCTATCCTCCTGCCTCGG + Intronic
1154446485 18:14439575-14439597 CTGAACCTCCCCCAGGGCCTTGG - Intergenic
1154947297 18:21174993-21175015 CTCAAGCAATCCAACTGCCTTGG - Intergenic
1155356748 18:24960713-24960735 CGCAACTACACCCACTGCCTGGG + Intergenic
1155594887 18:27474286-27474308 CTCAAGCTATCCGCCTGCCTCGG + Intergenic
1155904381 18:31431087-31431109 CTCAAGCTTTCCTCCTGCCTTGG - Intergenic
1156004216 18:32420675-32420697 CTCAAGCTGTCCGCCTGCCTTGG - Intronic
1156287028 18:35706720-35706742 CTCAACTTCTCCCTCTGCCCAGG - Intronic
1156569583 18:38238246-38238268 CACAACCTCTTCCCCTGCCTAGG - Intergenic
1157051996 18:44177017-44177039 CTCAACCACTGCCTCTGCATGGG + Intergenic
1157067370 18:44367211-44367233 CCCAACCCCTTCCACTTCCTGGG + Intergenic
1157334880 18:46730597-46730619 CTCAAGCTATCCCCCTGCCTTGG - Intronic
1157358059 18:46953404-46953426 CTCAAGCGCTCCGCCTGCCTTGG - Intronic
1157831551 18:50861108-50861130 CTCAACCAATCCTCCTGCCTCGG - Intergenic
1157849011 18:51030369-51030391 CTCACCCGCTCCCACCCCCTGGG - Exonic
1158256535 18:55556586-55556608 CTCAAGCTATCCACCTGCCTTGG + Intronic
1158293257 18:55965865-55965887 CTGAACCTCTGCCCCTTCCTTGG - Intergenic
1158389603 18:57034333-57034355 CTCAACCTCTCTGTCTGCCCAGG + Exonic
1158398226 18:57096439-57096461 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1159738212 18:72130893-72130915 CTCAACTTCTGCCACTAGCTAGG - Intergenic
1159780458 18:72654986-72655008 CTCTACCTTACCCACTCCCTTGG + Intergenic
1160588692 18:79927671-79927693 CTCAGCCTGTCCCACTCACTGGG - Intronic
1160707220 19:535307-535329 CTCATCCCCTCCCACGGCCTGGG + Intronic
1160776994 19:861097-861119 CTCGACCTCTCCTGCTGCATGGG + Intronic
1160777079 19:861351-861373 CTCGACCTCTCCTGCTGCATGGG + Intronic
1160854905 19:1212483-1212505 CTCAAGCTATCCGCCTGCCTGGG + Intronic
1161361740 19:3853833-3853855 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1161557676 19:4953697-4953719 CTCAAGCGATCCCCCTGCCTTGG + Intronic
1161622617 19:5306638-5306660 CCCAACCTCACCCAATGCCATGG + Intronic
1161712979 19:5860259-5860281 CTCAATCTTCCCCACTGTCTTGG - Intergenic
1161794384 19:6378103-6378125 CCCAGCCACCCCCACTGCCTGGG - Intronic
1162047863 19:8013171-8013193 CTCAAGCACTCCTCCTGCCTTGG + Intronic
1162102683 19:8349475-8349497 CTCAACCGTTCCTGCTGCCTCGG - Intronic
1162663817 19:12193267-12193289 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1162852299 19:13440195-13440217 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1162878180 19:13636579-13636601 CTCAAGCAATCCTACTGCCTGGG - Intergenic
1162885439 19:13693626-13693648 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
1163123370 19:15231526-15231548 CTCAGCCTCTGCCTCTGCCTGGG - Intronic
1163263513 19:16205176-16205198 CTCTCCCTCTCCCAATACCTGGG - Intronic
1163354470 19:16800899-16800921 CTCAAACAATCCTACTGCCTCGG - Intronic
1163355893 19:16810532-16810554 CTCAAGCAATCCCCCTGCCTCGG - Intronic
1163363156 19:16860715-16860737 CTCAGCCTCTCCCAGTAGCTGGG + Intronic
1163460227 19:17432914-17432936 CTCAAGCAATCCGACTGCCTTGG + Intronic
1163654013 19:18535151-18535173 CTCAACCAATCCACCTGCCTCGG + Intronic
1163826988 19:19529349-19529371 CTCCATCTCTCCCAGGGCCTTGG + Exonic
1163850114 19:19657913-19657935 CTCAAGCACTCCTCCTGCCTCGG - Intronic
1163890227 19:20005189-20005211 CTCAGCCTCTCCCAGTAGCTGGG + Exonic
1164444648 19:28307050-28307072 CTCAACCTATCCTCCTGCCTTGG + Intergenic
1164565326 19:29321832-29321854 CTCAAGCGCTCCACCTGCCTTGG + Intergenic
1164890901 19:31822264-31822286 CTCAACCTGACCCTCTGCATTGG - Intergenic
1165015736 19:32878732-32878754 CTCAATCTGTCCTCCTGCCTTGG - Intergenic
1165153316 19:33773276-33773298 CTCAGCCTCTCCCTCAGCCAAGG - Exonic
1165217783 19:34288896-34288918 CTCAACTGATCCGACTGCCTCGG - Intronic
1165223365 19:34336222-34336244 CTCAAGCGATCCCCCTGCCTTGG + Intronic
1165278793 19:34779332-34779354 CTCAAGCGATCCTACTGCCTTGG + Intergenic
1165533160 19:36421161-36421183 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1165633318 19:37320001-37320023 CTCAGCCTCTCCCAGTAGCTGGG + Intronic
1165669244 19:37661427-37661449 CTCAAGCAATCCCCCTGCCTAGG - Intronic
1165995868 19:39843534-39843556 CTCAAACTGTCCGCCTGCCTGGG - Intronic
1166518540 19:43464329-43464351 CTCCACCGCCCCCACGGCCTCGG + Exonic
1166545702 19:43633927-43633949 CTCAAGCAATCCCCCTGCCTTGG + Intronic
1166730716 19:45057629-45057651 CTCAGGCTCTCCCTCAGCCTAGG - Intronic
1166764865 19:45246656-45246678 CTCAAGCAATCCCCCTGCCTTGG - Intronic
1167138866 19:47635484-47635506 CTCAAGCTATCCACCTGCCTTGG + Intronic
1167323148 19:48808521-48808543 CTCAAGCTATCCTCCTGCCTCGG - Intronic
1167376031 19:49112514-49112536 CTCAAACAATCCCCCTGCCTTGG - Intergenic
1167611237 19:50508568-50508590 CTCCAGCTCTTCCCCTGCCTAGG + Intronic
1167623921 19:50574441-50574463 CTCAAGCTGTCCTCCTGCCTTGG + Intergenic
1167701456 19:51049611-51049633 CTCAACCAATCCTCCTGCCTTGG - Intergenic
1168111491 19:54193966-54193988 CTCAAGCGATCCCCCTGCCTTGG - Exonic
1168222740 19:54972690-54972712 CTCAACCGATCCTCCTGCCTTGG + Intronic
1168385707 19:55961566-55961588 CTCAAGCGCTCCTCCTGCCTTGG - Intronic
1168664009 19:58188786-58188808 CTCAAGCAATCCTACTGCCTTGG - Intronic
1168698273 19:58418560-58418582 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1168717084 19:58535599-58535621 CTCAAGCTATCCTCCTGCCTTGG + Intronic
925023341 2:588495-588517 CTGAACCTCCCCCAGGGCCTCGG + Intergenic
926618361 2:15022050-15022072 CTCAACTTCTTCCCCTGCCCAGG - Intergenic
926905840 2:17804877-17804899 CTCAAGCACTTCCACTGTCTGGG - Intergenic
927816998 2:26227276-26227298 CTCAAGTTATCCCCCTGCCTTGG - Intronic
927855546 2:26525368-26525390 CTCACCCTCTCCCAGTGGCAAGG + Intronic
928528944 2:32170830-32170852 CTCAAGTTATCCCTCTGCCTCGG + Intronic
928533172 2:32213138-32213160 CTTAAGCACTCCTACTGCCTTGG + Intronic
928615742 2:33037950-33037972 CTCAAGCAGTCCCCCTGCCTTGG + Intronic
929071368 2:38034297-38034319 CTCACCCTCTACCACTATCTTGG + Intronic
929169310 2:38915603-38915625 CTCAAGCTATCCACCTGCCTCGG + Intronic
929458909 2:42086766-42086788 CCCATCTTCTCCCACTGCCTCGG + Intergenic
929515414 2:42602208-42602230 CTCAAGCTGTCCACCTGCCTCGG + Intronic
929763360 2:44824609-44824631 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
929845139 2:45517759-45517781 CTCAAACTATCCCCCTGTCTTGG - Intronic
929860360 2:45671833-45671855 CTCAAGCAATCCCCCTGCCTCGG - Intronic
929999653 2:46852340-46852362 CTCAAGCAATCCCCCTGCCTTGG - Intronic
930092405 2:47540690-47540712 CTCAAGCAATCCCCCTGCCTTGG - Intronic
930677344 2:54217604-54217626 CTCAAGCGATCCCCCTGCCTCGG + Intronic
930814207 2:55575669-55575691 CTCAACCAATCCTCCTGCCTCGG + Intronic
931148244 2:59543515-59543537 CTCAAGCTATCCACCTGCCTCGG - Intergenic
931279657 2:60778409-60778431 CTCAACCAGTCCTCCTGCCTTGG + Intronic
931284551 2:60820969-60820991 CTCAAGCTATCCACCTGCCTTGG + Intergenic
931414606 2:62069228-62069250 CTCAAGCTATCCTCCTGCCTTGG + Intronic
931438838 2:62272654-62272676 CTCAAGCTATCCACCTGCCTCGG - Intergenic
932017864 2:68051283-68051305 CTCAAGCTGTCCTCCTGCCTTGG - Intronic
932178772 2:69626731-69626753 CTCAAGCAATCCCCCTGCCTTGG + Intronic
932290754 2:70576453-70576475 CTCAAGCCATCCCTCTGCCTTGG - Intergenic
932689969 2:73904023-73904045 CTCAAGCTATCCTCCTGCCTTGG - Intronic
932814832 2:74853281-74853303 CTCAAGCTATCCACCTGCCTCGG - Intronic
933690746 2:85177604-85177626 CTCAAGCAATCCTACTGCCTCGG - Intronic
934091192 2:88552125-88552147 ATCAAACTCTCTCACTCCCTTGG + Intergenic
934778623 2:96954814-96954836 CTCAAGCTATCCTCCTGCCTGGG - Intronic
934909781 2:98241204-98241226 CCCAAGCTCCCCCACTGCCTGGG - Intronic
935089867 2:99884875-99884897 CCCAGCCTCTCCCTCTACCTGGG + Intronic
936341474 2:111637262-111637284 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
936796837 2:116216222-116216244 CTCAAGCTGTCCTTCTGCCTTGG - Intergenic
937386141 2:121435085-121435107 CTCAAGCTGTCCTTCTGCCTAGG - Intronic
937422123 2:121766368-121766390 CTCAAGCAGTCCCCCTGCCTCGG - Exonic
937448960 2:121984594-121984616 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
937938954 2:127270256-127270278 CTCAAGCTATCCTCCTGCCTTGG + Intronic
937962974 2:127476669-127476691 CTCAAGCGATCCCCCTGCCTTGG - Intronic
938006822 2:127793899-127793921 CTCAATCTTTCCTCCTGCCTTGG - Intronic
938020096 2:127899302-127899324 CTCAAGCTATCCTCCTGCCTAGG - Intergenic
938168984 2:129058230-129058252 CTCAAGCAATCCAACTGCCTCGG + Intergenic
938414168 2:131090843-131090865 CTCAGCCTCCCCCAGTGGCTGGG + Intronic
938483470 2:131680658-131680680 CTGAACCTCCCCCAGGGCCTCGG + Intergenic
938542138 2:132292227-132292249 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
938598994 2:132818179-132818201 CTCAAGCTATCCACCTGCCTCGG + Intronic
938860301 2:135361011-135361033 CTCAACCAATCCTCCTGCCTTGG + Intronic
938905838 2:135835348-135835370 CTCAAGCAATCCCCCTGCCTTGG + Intronic
938968281 2:136407620-136407642 CTCTTCCTCTCCCATTCCCTGGG + Intergenic
938980638 2:136522874-136522896 CTCAGCCTCTCTCACTTCTTTGG + Intergenic
939207419 2:139125263-139125285 CTCAAGCAGTCCCCCTGCCTTGG - Intergenic
939322115 2:140637604-140637626 CTCAAATTCTCTCACTGCTTGGG + Intronic
939418723 2:141937259-141937281 CTCAGCCTCTCCCAGTAGCTGGG - Intronic
939742557 2:145927369-145927391 CACAATCTCTCCCACTCACTTGG + Intergenic
939799918 2:146696653-146696675 CTCAACTGATCCTACTGCCTTGG - Intergenic
939840535 2:147182395-147182417 CCCAACCTCTTGCACTTCCTGGG - Intergenic
939897611 2:147810823-147810845 CTCAAGCAATCCTACTGCCTCGG - Intergenic
939913678 2:148014108-148014130 CTCAAGCTATCCTCCTGCCTTGG - Intronic
940899403 2:159112812-159112834 CTCAAGCTATCCCCCAGCCTTGG + Intronic
941043464 2:160648457-160648479 CTGCACCTCACCCACTGCCCTGG + Intergenic
941489425 2:166125353-166125375 TTCAGCCTCTCCAACTGCCCAGG + Intronic
941648895 2:168071751-168071773 CTCAGCCTCTCCCAGTAGCTGGG - Intronic
941685232 2:168441138-168441160 CTCAACTAATCCCCCTGCCTTGG + Intergenic
942013982 2:171792530-171792552 CTCAAGCAATCCCCCTGCCTTGG + Intronic
942117931 2:172747562-172747584 CTCAAGCGATCCCTCTGCCTTGG + Intronic
942597923 2:177609661-177609683 CTCAAGCTATCCATCTGCCTTGG - Intergenic
942759177 2:179378174-179378196 CTCAAGCTATCCACCTGCCTTGG + Intergenic
942850162 2:180474745-180474767 CTCAGCCTCTCTCTCTGTCTGGG - Intergenic
943584162 2:189718217-189718239 CTCAAGCTATCCTCCTGCCTTGG - Intronic
943681244 2:190770237-190770259 TTCATCCTCAACCACTGCCTGGG + Intergenic
944526320 2:200623667-200623689 CTAAACTTCCCCCAGTGCCTCGG + Intronic
944539947 2:200745389-200745411 CTCAAACTATCCAGCTGCCTTGG + Intergenic
944593118 2:201236837-201236859 CTCAAGCTATCCATCTGCCTCGG + Intronic
945026002 2:205620632-205620654 CTCAGCTTCTCCCTCTGCCCAGG - Intergenic
945939481 2:215933636-215933658 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
946303058 2:218836522-218836544 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
946824263 2:223660519-223660541 CTCAAGCTGTCCTCCTGCCTTGG - Intergenic
947254161 2:228143306-228143328 CTCAAGCTATCCTCCTGCCTTGG - Intronic
947545249 2:231005928-231005950 CTCAAGTTATCCCCCTGCCTGGG - Intronic
947550920 2:231046057-231046079 CTCAAGCTATCCCCCTGCCTCGG - Intronic
947672714 2:231949018-231949040 CTCAAGCGCTCCACCTGCCTTGG + Intergenic
947837550 2:233186566-233186588 CTCAAGCAATCCCCCTGCCTTGG - Intronic
947883407 2:233542475-233542497 CTCAAGCAGTCCCTCTGCCTCGG - Intronic
947902891 2:233737494-233737516 CTCACCCTCTTGCACTTCCTAGG + Intronic
947987085 2:234457904-234457926 CTCAAGCGATCCCCCTGCCTTGG - Intergenic
948862259 2:240758319-240758341 CTCAATCTCTCTCTCTGCCAAGG + Intronic
1169044145 20:2522713-2522735 CTCAAGCTATCCACCTGCCTTGG - Intronic
1169126655 20:3132886-3132908 CTCAAGCAATCCCCCTGCCTTGG - Intronic
1169175602 20:3509735-3509757 CTCAAGCTATCCACCTGCCTTGG + Intronic
1169384205 20:5134209-5134231 AGCACCCTCACCCACTGCCTGGG - Intronic
1169518092 20:6339761-6339783 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1169623728 20:7539325-7539347 CTCAAACTATCCACCTGCCTTGG - Intergenic
1169630936 20:7630552-7630574 CTCAACCGATCCACCTGCCTCGG - Intergenic
1169954322 20:11084424-11084446 CTCAACTTGTCCTCCTGCCTTGG - Intergenic
1170291628 20:14776384-14776406 TTCAACCTCACCAACAGCCTTGG - Intronic
1170456867 20:16541752-16541774 CTCCACTTCTCCCTCTGCCTGGG - Intronic
1170774618 20:19364686-19364708 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1170864624 20:20142519-20142541 CTCAACCTCTGCCAGTCCCTGGG - Intronic
1171152930 20:22843709-22843731 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
1171418612 20:25001044-25001066 CTCAACCAGTCCTCCTGCCTTGG + Intergenic
1171440240 20:25154838-25154860 CTCAAGCAATCCAACTGCCTTGG + Intergenic
1171871024 20:30525101-30525123 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1172073255 20:32274501-32274523 CTCAAGCAATCCCCCTGCCTCGG - Intergenic
1172109739 20:32538010-32538032 CTCAAGTGATCCCACTGCCTCGG + Intronic
1172141713 20:32726995-32727017 CTCAAGCTGTCCTCCTGCCTTGG - Intronic
1172150724 20:32788669-32788691 CTCAAGCGATCCCCCTGCCTCGG + Intronic
1172446921 20:34998065-34998087 CTCACCCTGACCCACTGCCCTGG + Intronic
1172492637 20:35352779-35352801 CTCAAGCTATCCTCCTGCCTCGG + Intronic
1172514864 20:35526390-35526412 CTCAAGCAATCCTACTGCCTTGG - Intronic
1172576097 20:36009943-36009965 CTCAATCTCTCCCCGTACCTTGG - Intronic
1172682304 20:36726155-36726177 CTCAAGCAATCCCCCTGCCTTGG + Intronic
1172697079 20:36830330-36830352 CTCAAGCGATCCCCCTGCCTCGG - Intronic
1172709327 20:36908469-36908491 CTCAAGCGATCCAACTGCCTTGG + Intronic
1173000125 20:39099507-39099529 CACACCCTCTCCCTCTTCCTAGG + Intergenic
1173789112 20:45816146-45816168 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1174272290 20:49378440-49378462 CTCAAGCTGTCCTCCTGCCTTGG + Intronic
1174770707 20:53297466-53297488 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1174778901 20:53370525-53370547 CTCAATCTATCCGTCTGCCTCGG - Intronic
1174833068 20:53831411-53831433 CTCAAGCTCTCTGCCTGCCTTGG - Intergenic
1175393785 20:58644632-58644654 CTCAAACTATCCACCTGCCTTGG - Intergenic
1176195572 20:63835220-63835242 CTCTGCCTCTCCCTCTGTCTGGG - Intergenic
1176449497 21:6850268-6850290 CTGAACCTCCCCCAGGGCCTTGG + Intergenic
1176827667 21:13715292-13715314 CTGAACCTCCCCCAGGGCCTTGG + Intergenic
1177044174 21:16148811-16148833 CTGAACCCCTGCCACAGCCTGGG - Intergenic
1177787756 21:25690579-25690601 CTCAACCCATCCTCCTGCCTCGG + Intronic
1179510701 21:41871363-41871385 CACCACCTCTGCCTCTGCCTGGG + Intronic
1179523457 21:41960173-41960195 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
1179778112 21:43681004-43681026 CTCAAGTTATCCGACTGCCTGGG - Intronic
1180013628 21:45068796-45068818 CTCAAGCAGTCCCCCTGCCTTGG + Intergenic
1180239477 21:46490732-46490754 GTCCACCTTCCCCACTGCCTAGG - Intronic
1180277924 22:10663056-10663078 CTCAGCCTCTCCGAGTGGCTGGG - Intergenic
1180585164 22:16881889-16881911 CTCAGCCTCTCCCAGTGGCTGGG - Intergenic
1181020040 22:20095149-20095171 ATCAAACTCTGTCACTGCCTGGG - Intronic
1181055421 22:20258527-20258549 CTCAACCTCACCCTGGGCCTGGG + Intronic
1181118214 22:20647455-20647477 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
1181813251 22:25418274-25418296 CTCAAGCTATCCACCTGCCTCGG + Intergenic
1182269080 22:29142204-29142226 CCCCTCCTCTCCCTCTGCCTCGG + Intronic
1182280515 22:29215463-29215485 CATGACCTCTCCCACTGCCCTGG - Intronic
1182613520 22:31569712-31569734 CTCAAGCTGTCCCCCCGCCTTGG - Intronic
1182710183 22:32317697-32317719 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
1182926423 22:34129518-34129540 CTAAACCTTTCCCACACCCTTGG + Intergenic
1183435443 22:37791630-37791652 CTCAACCTCTCCGAGTAGCTGGG - Intergenic
1183541770 22:38433548-38433570 CTCAAGCTATCCTCCTGCCTCGG + Intronic
1183791673 22:40076181-40076203 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1183861722 22:40675078-40675100 CTCAAGGTATCCTACTGCCTCGG - Intergenic
1183969412 22:41465484-41465506 CCCAATCTCTCCCACTTACTGGG + Intronic
1184032658 22:41904109-41904131 CTCAAGCTGTCCTCCTGCCTCGG + Intronic
1184183609 22:42848734-42848756 CACAACCTCTTCCTCTGGCTGGG - Intronic
1184467125 22:44675324-44675346 CTCAAACTGTCCTCCTGCCTTGG + Intronic
1185177022 22:49333731-49333753 CTCAGCCTCTCCCATTCCCTGGG + Intergenic
1185235272 22:49708855-49708877 CCCAACCTCTCATCCTGCCTTGG + Intergenic
1185391981 22:50567044-50567066 CTCAGCCTCTCCCAGTAGCTGGG + Intergenic
949208305 3:1467249-1467271 CTCAAGCAATCCCCCTGCCTAGG + Intergenic
949384876 3:3489822-3489844 CTCACCCTCCCCCAGTGCCCAGG + Intergenic
949413187 3:3787662-3787684 CTCAAGTTATCCAACTGCCTTGG + Intronic
949559455 3:5188268-5188290 CTCAACCCCATCCACTGCCGCGG + Exonic
950308664 3:11936706-11936728 CTCAAGCGATCCCACTGCCTCGG + Intergenic
951340521 3:21481037-21481059 CACCACCTCTCACTCTGCCTAGG - Intronic
951511991 3:23512470-23512492 CTCAACCAGTCCTCCTGCCTTGG + Intronic
951567477 3:24025797-24025819 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
952119778 3:30228464-30228486 CTCAACCTATCTGCCTGCCTCGG - Intergenic
952340372 3:32440542-32440564 CTCAAGCAATCCCCCTGCCTTGG - Intronic
952360889 3:32629024-32629046 CTCAACCAATCCACCTGCCTTGG - Intergenic
952438382 3:33296297-33296319 CTCAAGCTATCCACCTGCCTTGG + Intronic
953152342 3:40336057-40336079 CTCAACCGATCCTCCTGCCTTGG - Intergenic
953276344 3:41502774-41502796 CTCAACCCCTCCCACTTCCTGGG - Intronic
953630248 3:44609408-44609430 CTCAAGCAATCCAACTGCCTCGG - Intronic
953850736 3:46464022-46464044 CTGTGCCCCTCCCACTGCCTAGG + Intronic
953893794 3:46778059-46778081 CTCAAGCGATCCCCCTGCCTTGG - Intronic
954860943 3:53689891-53689913 CTCAAGCTATCCTCCTGCCTTGG + Intronic
955335947 3:58086232-58086254 CTCAAGCAATCCCCCTGCCTTGG + Intronic
956145462 3:66187060-66187082 CTCAACTTCACCCAGAGCCTTGG + Intronic
956158489 3:66323570-66323592 CTCAACCAATCCGCCTGCCTCGG - Intronic
956355643 3:68389742-68389764 CTCAACCTCTTACACTTCCTGGG - Intronic
957199222 3:77110925-77110947 CTCAAGCTATCCAACTGCCTTGG + Intronic
957993329 3:87654134-87654156 CCCAACCCCTTGCACTGCCTGGG + Intergenic
958197059 3:90255070-90255092 CTCAAGCGATCCTACTGCCTTGG + Intergenic
959378899 3:105618119-105618141 CTCAAGTAATCCCACTGCCTCGG - Intergenic
959516752 3:107275904-107275926 CTCAAGCTATCCGCCTGCCTTGG - Intergenic
960606869 3:119515128-119515150 TGCAACCTCTGCCTCTGCCTAGG - Intronic
960759441 3:121056036-121056058 CTCAAGCTATCCTCCTGCCTTGG + Intronic
960760155 3:121064232-121064254 CTCAACCCCTTGCACTTCCTGGG + Intronic
961139914 3:124547231-124547253 CTCAAGCTATCCTCCTGCCTGGG + Intronic
961234654 3:125355651-125355673 CTCAAGCTATCCTCCTGCCTCGG - Intronic
961355971 3:126340259-126340281 CTCAGCCTCATCCACTGCCAGGG - Intergenic
961405227 3:126673571-126673593 TTCAGCTTCTCCCACTTCCTGGG + Intergenic
961557602 3:127707252-127707274 CTCCACCCCTTCCACAGCCTGGG + Intronic
961834199 3:129643205-129643227 CTCAACCAATCCACCTGCCTTGG + Intergenic
962541671 3:136389027-136389049 CTCAACCAATCCTCCTGCCTCGG + Intronic
962752858 3:138446790-138446812 CTCAAGCTATCCGCCTGCCTTGG - Intronic
963808360 3:149749235-149749257 CTCAAGCTATCCGCCTGCCTTGG + Intronic
963988605 3:151627250-151627272 CTCAAGCTATCCTTCTGCCTTGG + Intergenic
964092095 3:152889260-152889282 CTCAAGCGGTCCAACTGCCTTGG + Intergenic
964573071 3:158132217-158132239 CTCAAGCGATCCCCCTGCCTTGG + Intronic
964849563 3:161080858-161080880 CTCCACCTCAGCCACTGCCCTGG + Intergenic
965571475 3:170177902-170177924 CTCAAGCTATCTCCCTGCCTTGG + Intronic
965797455 3:172455919-172455941 CTCAAGCGATCCCCCTGCCTTGG + Intergenic
966416082 3:179690805-179690827 CTCAAGCGATCCAACTGCCTCGG + Intronic
966752480 3:183335632-183335654 CTCAACCTATCCTCCTGCCTGGG - Intronic
966799584 3:183750190-183750212 CTCAAGCTGTCCGCCTGCCTTGG + Intronic
967185248 3:186939304-186939326 CTCAACCGATCCTCCTGCCTTGG + Intronic
967240398 3:187433028-187433050 CTCAAGCTATCCACCTGCCTTGG - Intergenic
967462531 3:189763035-189763057 CTCAAGCTATCCTCCTGCCTCGG - Intronic
967625332 3:191677061-191677083 CTCAAGCTGTCCTCCTGCCTTGG + Intergenic
967807105 3:193724976-193724998 CTCAACCAGTCCTTCTGCCTCGG + Intergenic
967939296 3:194754049-194754071 CTCAGCATCTCCCCCTGCCCAGG + Intergenic
968000552 3:195203040-195203062 CTCAAGCAATCCTACTGCCTCGG + Intronic
968003585 3:195224460-195224482 CTCACCCTCTCCCAGAGCTTAGG + Intronic
968048688 3:195638712-195638734 CTCAAACGATCCCCCTGCCTCGG - Intergenic
968098718 3:195950912-195950934 CTCAAACGATCCCCCTGCCTCGG + Intergenic
968139943 3:196247589-196247611 CCCATCTTCTCCCACTGCTTAGG + Intronic
968397803 4:259807-259829 CTCTCCCTCTCTCTCTGCCTCGG + Intergenic
968488011 4:873525-873547 GTCTACCTGTTCCACTGCCTGGG + Intronic
969683963 4:8659047-8659069 CTCAAGTGATCCCACTGCCTGGG - Intergenic
970186525 4:13460447-13460469 CTCAAGCAATCCCCCTGCCTTGG + Intronic
970461759 4:16281398-16281420 CTCAAGCAATCCCCCTGCCTCGG + Intergenic
970563101 4:17302543-17302565 CTCAAGTGCTCCCCCTGCCTTGG - Intergenic
970596841 4:17608554-17608576 CTCAAGCAATCCTACTGCCTTGG - Intergenic
970992482 4:22228790-22228812 CTCAAACTATCCTCCTGCCTTGG - Intergenic
971560716 4:28077142-28077164 CCCAACCTCTTGCACTTCCTGGG - Intergenic
971648367 4:29238049-29238071 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
971991246 4:33897878-33897900 CTCAGCCTATCCACCTGCCTGGG - Intergenic
972151134 4:36092491-36092513 CTCAACCTCCTCCAGTGGCTCGG - Intronic
972153549 4:36127067-36127089 CTCAAGCTATCCTCCTGCCTTGG + Intronic
972316470 4:37931328-37931350 CTCAAGCTATCCACCTGCCTCGG + Intronic
972465709 4:39354846-39354868 CTCAAGCAGTCCAACTGCCTCGG - Intronic
972585421 4:40433192-40433214 CTCAAGCGATCCAACTGCCTTGG + Intronic
972598704 4:40552806-40552828 CTCATCCTCTTCTCCTGCCTTGG + Intronic
972641386 4:40928307-40928329 CTCAGGCGATCCCACTGCCTCGG - Intronic
972732821 4:41812023-41812045 CTCAAACTATCCTGCTGCCTTGG - Intergenic
972748655 4:41966914-41966936 CTCAAGCGATCCCTCTGCCTTGG - Intergenic
973305422 4:48643178-48643200 GTCAACCTCCCCCAGTCCCTGGG - Intronic
973336843 4:48965220-48965242 CTCAAACTCTGGCACTTCCTGGG - Intergenic
973937079 4:55857293-55857315 CTCAGCCTCTCCCAGTAGCTGGG + Intronic
975168669 4:71208040-71208062 CTCAAGCCATCCCTCTGCCTTGG + Intronic
975725480 4:77287419-77287441 CTCTGCTTCTCCCACTGTCTAGG + Intronic
976280264 4:83320329-83320351 CTCAAGCTATCCATCTGCCTTGG - Intronic
976549226 4:86375485-86375507 CTCAAGCTATCCACCTGCCTTGG - Intronic
976617356 4:87092048-87092070 CTCAAGCGATCCAACTGCCTTGG - Intronic
977077140 4:92469011-92469033 CTCAACCTATGTCACTGCCTGGG + Intronic
977500199 4:97828268-97828290 CTCAACCCCTTGCACTTCCTGGG - Intronic
977511189 4:97965046-97965068 CTCAACCTCTTGCGCTTCCTGGG - Intronic
977599213 4:98917840-98917862 CTCAAGCAGTCCTACTGCCTTGG - Intronic
977604284 4:98966729-98966751 CTCAAGCTATCCTTCTGCCTTGG + Intergenic
977616279 4:99090165-99090187 CACAACTTCTCCCTCTCCCTCGG + Intergenic
979352812 4:119665447-119665469 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
980046061 4:127990327-127990349 CTCAAGTGATCCCACTGCCTTGG - Intronic
980669150 4:135981340-135981362 CTCAATCACTCCGCCTGCCTCGG + Intergenic
980731109 4:136824894-136824916 CTCAACCTCTCCGAGTAGCTGGG - Intergenic
980771948 4:137385113-137385135 CTCAAGTTATCCCCCTGCCTCGG + Intergenic
981350653 4:143725674-143725696 GTCATCATCTCCCTCTGCCTTGG + Intergenic
981512651 4:145574524-145574546 CCCAACCTCTTGCACTTCCTGGG - Intergenic
981943889 4:150318090-150318112 CTCAAACTCTGCCACTGACTGGG - Intronic
981944065 4:150320184-150320206 CTCAAACTCCGCCACTGACTGGG + Intronic
982552618 4:156821781-156821803 CTCAACTGATCCCCCTGCCTTGG + Intronic
983379491 4:166973186-166973208 CCCACTCTCTCCCACTGCCTTGG + Intronic
984296301 4:177858679-177858701 CTCAAGCGATCCCACTGCTTTGG - Intronic
984360905 4:178730664-178730686 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
984899611 4:184573486-184573508 CTCAAGCAATCCAACTGCCTTGG - Intergenic
984911132 4:184675581-184675603 CTCAAGCTATCCACCTGCCTTGG - Intronic
985150153 4:186938627-186938649 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
985742962 5:1630441-1630463 CTCAAGCGATCCCCCTGCCTCGG + Intergenic
986010435 5:3709790-3709812 CTACACCTGACCCACTGCCTTGG - Intergenic
986514017 5:8541871-8541893 CTCCCCCTCTCTCTCTGCCTTGG + Intergenic
987157818 5:15108725-15108747 CTCAAACTATCCTCCTGCCTTGG + Intergenic
988728081 5:33943322-33943344 CTCAAGGTATCCCCCTGCCTCGG + Intergenic
989016341 5:36939234-36939256 CTCAAACTATCCATCTGCCTCGG + Intronic
989463112 5:41724359-41724381 CTCAAGCTATCCACCTGCCTCGG + Intergenic
990517825 5:56546960-56546982 CTTTGCCTCTCCTACTGCCTGGG + Intronic
990674117 5:58163934-58163956 CTCAACCAATCCTCCTGCCTCGG + Intergenic
990683285 5:58270093-58270115 CTCAAGCTATCCACCTGCCTTGG + Intergenic
991721341 5:69496637-69496659 CTCAAACAATCCCTCTGCCTTGG + Intronic
991721917 5:69501394-69501416 CTCAAGCTATCCACCTGCCTTGG - Intronic
991961783 5:72052039-72052061 CTCAACCTCTGTCTCTTCCTAGG - Intergenic
992441725 5:76802971-76802993 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
992443593 5:76815391-76815413 CTCAACCAATCCTTCTGCCTTGG + Intergenic
992805910 5:80337701-80337723 CTCAAACGATCCCCCTGCCTTGG + Intergenic
992997491 5:82347474-82347496 CTCAGCTCCTTCCACTGCCTGGG - Intronic
993280204 5:85916422-85916444 CTCAACGTATCCACCTGCCTAGG + Intergenic
994323941 5:98426982-98427004 CCCAAGCTATCCCCCTGCCTTGG - Intergenic
995885622 5:116891072-116891094 CTCAAGCTATCCCCCTGCCTCGG + Intergenic
996644907 5:125801618-125801640 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
996721368 5:126633591-126633613 CTCAAGCAATCCTACTGCCTCGG + Intronic
996812074 5:127527517-127527539 CTCAAGCAATCCCCCTGCCTGGG - Intronic
997076748 5:130687692-130687714 TTCAACCTCCCCCTCTGCTTTGG + Intergenic
997086143 5:130801940-130801962 CTCAAATTCTCCCTCTACCTGGG + Intergenic
997275320 5:132582239-132582261 CTCAACCTCTGCTACAGCCTTGG - Intronic
997372258 5:133369604-133369626 CACAGCCCCTCCCACTGCCCAGG + Intronic
997511296 5:134456356-134456378 TTCAAGCTCTCCTCCTGCCTCGG - Intergenic
997540848 5:134660788-134660810 CTCAAGCTATCCACCTGCCTTGG + Intronic
997912284 5:137888204-137888226 CTCAACCTCTCCCAGCAGCTGGG - Intronic
997972175 5:138412418-138412440 CTCAAGCAATCCCACTGCCTTGG - Intronic
998106413 5:139471865-139471887 CTCTACCTCTCCCGCCGCCAGGG + Intergenic
998195872 5:140070663-140070685 CTCAAGCAATCCTACTGCCTTGG - Intergenic
998368271 5:141644925-141644947 CTCATCCTCACGCCCTGCCTGGG + Exonic
998457549 5:142284881-142284903 CTCAAGCTATCCTCCTGCCTGGG - Intergenic
998538665 5:142958431-142958453 CTCAAGCAATCCCCCTGCCTTGG - Intronic
999234813 5:150084101-150084123 CTCAAGCGATCCCCCTGCCTTGG - Intronic
999365661 5:151021750-151021772 CCCACCCACTCCCACTCCCTGGG - Intronic
999388893 5:151175620-151175642 CTCAACCTATCTTCCTGCCTTGG + Intergenic
999975113 5:156904576-156904598 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
1000210407 5:159102329-159102351 GTCAATCCCTCCCCCTGCCTGGG + Intergenic
1000318677 5:160117224-160117246 CTCAAGCGATCCTACTGCCTTGG - Intronic
1001130809 5:169061913-169061935 CTGAGTCTATCCCACTGCCTTGG + Intronic
1001389939 5:171370713-171370735 CTCATGCTATCCCCCTGCCTTGG + Intergenic
1001408069 5:171489951-171489973 CTCAAGCACTCCTCCTGCCTCGG + Intergenic
1001613824 5:173025729-173025751 CTCAAGCGATCCAACTGCCTTGG + Intronic
1001838419 5:174852454-174852476 CTCAACCTCTCTGTCTCCCTGGG + Intergenic
1002012682 5:176296428-176296450 CTCAAACTGTCCTCCTGCCTCGG - Intronic
1002215157 5:177626306-177626328 CTCAAACTGTCCTACTGCCTCGG + Intergenic
1003008769 6:2406992-2407014 CTCAAGCTGTCCTCCTGCCTTGG - Intergenic
1003138471 6:3452357-3452379 CTCAAGCTGTCCTTCTGCCTCGG - Intronic
1004356794 6:14936256-14936278 CTCAAGCTGTCCTCCTGCCTCGG - Intergenic
1004390661 6:15206994-15207016 CTCAAGCAATCCTACTGCCTTGG - Intergenic
1004563661 6:16775379-16775401 CTCAAGCAGTCCCCCTGCCTTGG + Intergenic
1004941268 6:20558860-20558882 CTCAACCAATCCACCTGCCTCGG + Intronic
1005554247 6:26956832-26956854 CTAAGCCTCTCTCACTGCCCAGG + Intergenic
1005865177 6:29932049-29932071 CTCTCCCTCTCCCTCTGCCACGG + Intergenic
1005903559 6:30240715-30240737 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1006518785 6:34559604-34559626 CTCAAGCTATCCACCTGCCTCGG + Intergenic
1006541166 6:34741068-34741090 CTCAAGTTATCCCCCTGCCTCGG + Intergenic
1006587225 6:35123718-35123740 CTCAATCTATCCTCCTGCCTTGG + Intronic
1007148299 6:39660075-39660097 CTCAAGCAATCCTACTGCCTCGG - Intronic
1007258529 6:40545584-40545606 CTCTTCCTCTTCCTCTGCCTGGG - Intronic
1007388317 6:41534451-41534473 CTCAACCAATCCTCCTGCCTTGG + Intergenic
1008161697 6:48084975-48084997 CTCAGGCTATCCCCCTGCCTCGG + Intergenic
1008267965 6:49454810-49454832 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1011471817 6:87715883-87715905 CTCAAGCTATCCTGCTGCCTTGG - Intergenic
1011476337 6:87752516-87752538 CTCAAGCTATCCACCTGCCTCGG - Intergenic
1011677941 6:89753813-89753835 CTCAAGCTGTCCTCCTGCCTTGG - Intronic
1012645952 6:101681466-101681488 CTCAACCAGTCCTCCTGCCTTGG + Intronic
1012764473 6:103348696-103348718 CTCAACCAGTCCGTCTGCCTTGG - Intergenic
1013085500 6:106853521-106853543 CTCAAGCAATCCAACTGCCTCGG + Intergenic
1013149914 6:107435041-107435063 CTCAACCAATCCTCCTGCCTTGG - Intronic
1013201454 6:107900406-107900428 CTCAACTGCTCCACCTGCCTTGG - Intronic
1013237528 6:108210473-108210495 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
1013247777 6:108303278-108303300 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1013530350 6:111013901-111013923 CTCAAGCACTCCTCCTGCCTTGG - Intronic
1013773077 6:113649095-113649117 CCCATCCTCTCACACTCCCTGGG - Intergenic
1014250985 6:119115456-119115478 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1015359701 6:132325082-132325104 CTCAACCTCCCTAACAGCCTTGG + Intronic
1015728340 6:136322760-136322782 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1015915507 6:138212292-138212314 CTCAAGCCATCCCCCTGCCTTGG - Intronic
1015968613 6:138720708-138720730 CTCAAGTGATCCCACTGCCTCGG - Intergenic
1017149244 6:151263266-151263288 CTCAAGCAATCCCCCTGCCTTGG + Intronic
1018030527 6:159837661-159837683 CTCAAGCAATCCCCCTGCCTCGG - Intergenic
1018094594 6:160374267-160374289 CTCAACCCCTTGCACTTCCTGGG + Intronic
1019527511 7:1487378-1487400 CTCAACCAGTCCCTCCGCCTCGG - Exonic
1019531401 7:1505267-1505289 CTCAACCGATCCTCCTGCCTTGG - Intergenic
1019691772 7:2419029-2419051 CTCAAGCAATCCCCCTGCCTTGG + Intronic
1019747371 7:2708489-2708511 GTCATCCTCTTCCTCTGCCTGGG - Intronic
1020091323 7:5343658-5343680 CTCAACCAATCCTCCTGCCTTGG + Intronic
1020228894 7:6301762-6301784 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1020268624 7:6578361-6578383 CTCAAGCTATCCTCCTGCCTGGG + Intronic
1020283352 7:6662888-6662910 CTCAAGCTATCCGCCTGCCTCGG + Intergenic
1020520087 7:9174162-9174184 CTCTCCCTCTCCCAGTGCCCAGG + Intergenic
1020918409 7:14228752-14228774 CTCAACCTCTACCATTGCTCTGG + Intronic
1021016244 7:15538465-15538487 CTCAAACTATCCTCCTGCCTTGG + Intronic
1021740608 7:23681639-23681661 CTCAAGCTATCCACCTGCCTCGG + Intronic
1021744525 7:23725299-23725321 CTCAACCAATCCTCCTGCCTCGG - Intronic
1021797351 7:24269752-24269774 CTCAGCCTCTCAAAGTGCCTGGG + Intergenic
1021980873 7:26054203-26054225 CTCAAGCTATCCACCTGCCTTGG - Intergenic
1022147472 7:27559386-27559408 CTCAAGCAATCCCCCTGCCTTGG - Intronic
1022279237 7:28889472-28889494 CTCAAGCGATCCCCCTGCCTGGG - Intergenic
1022594759 7:31702460-31702482 CTCAAGCTCTGCCACTGTCCAGG + Intronic
1023163663 7:37322242-37322264 CTCAAACTATCCACCTGCCTTGG - Intronic
1023376300 7:39559212-39559234 CTCAAGCTATCCGCCTGCCTTGG + Intergenic
1023420460 7:39974297-39974319 CTCAAGCGCTCCTCCTGCCTTGG + Intronic
1023539639 7:41251627-41251649 CTCATCCTCTCCCACCTCCTAGG - Intergenic
1023944532 7:44793288-44793310 CTCAACCGATCCTCCTGCCTTGG + Intergenic
1024143334 7:46484331-46484353 CTCAAGCAATCCAACTGCCTCGG - Intergenic
1024512370 7:50213820-50213842 CTCAGCCCCTCCCACTGCCCTGG - Intergenic
1025752718 7:64307320-64307342 CTTAACCTCTCGCAGTCCCTAGG - Intergenic
1025959363 7:66206190-66206212 CTCAAGCTATCCTTCTGCCTCGG + Intronic
1026303713 7:69122009-69122031 CTCAAGCCCTCCTCCTGCCTTGG + Intergenic
1026371585 7:69705098-69705120 CTCAAGCTCTCTGCCTGCCTCGG + Intronic
1026841375 7:73671432-73671454 CTCCTCCTCCCCCACTGCCTGGG + Exonic
1026863974 7:73811204-73811226 TTCAGCCTCTCCCAGAGCCTTGG + Intronic
1026917174 7:74127568-74127590 CTCAACCAATCCTCCTGCCTTGG - Intergenic
1029140077 7:98402949-98402971 CTCAACCAGTCCTCCTGCCTTGG - Intergenic
1029140790 7:98408439-98408461 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
1029325044 7:99799600-99799622 CCCACCCTCACCCACTGCCCTGG + Intergenic
1029337241 7:99912295-99912317 CTCAAGCTGTCCACCTGCCTTGG - Intronic
1029360504 7:100085261-100085283 CTCAACCGATCCACCTGCCTCGG - Intergenic
1029539764 7:101175692-101175714 CTCAACCAGTCCACCTGCCTTGG - Intronic
1029799735 7:102933979-102934001 CTCGGCTTCTCACACTGCCTGGG - Exonic
1029873758 7:103725317-103725339 CTCAAGCAGTCCTACTGCCTTGG - Intronic
1031323639 7:120364750-120364772 CTCATCCTCTACCACTCCCCAGG - Intronic
1031461088 7:122050207-122050229 CTCAAGCAATCCCCCTGCCTTGG - Intronic
1031666615 7:124492006-124492028 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
1032200336 7:129817495-129817517 CTCAAGCTATCCTCCTGCCTCGG + Intergenic
1032249186 7:130239371-130239393 CTCAACCAATCCTCCTGCCTTGG - Intergenic
1032334248 7:131010280-131010302 CTCAAGCTGTCCTTCTGCCTCGG - Intergenic
1032549543 7:132771680-132771702 CTCCCCCTCTACCACTTCCTGGG + Intergenic
1033219085 7:139516141-139516163 CTCAGCCTCCCCGCCTGCCTTGG - Intergenic
1033304025 7:140211144-140211166 CTCAACCGATCCTCCTGCCTCGG - Intergenic
1033423432 7:141222378-141222400 TTCCACCTCTGCCACTGTCTAGG + Intronic
1033457633 7:141517000-141517022 CTCAAGCACTCCACCTGCCTTGG + Intergenic
1034913050 7:155013405-155013427 CTCAAACTATCCACCTGCCTTGG - Intergenic
1035389138 7:158494168-158494190 CACCACCTCTCTCACTGGCTGGG + Intronic
1035620552 8:1033567-1033589 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1036191171 8:6671540-6671562 GACAACCTCTCCCACAGCCAGGG + Intergenic
1036654689 8:10670643-10670665 CTCAAGCCATCCCCCTGCCTTGG - Intronic
1036667583 8:10757547-10757569 CTCAAGCTATCCTCCTGCCTTGG + Intronic
1036755701 8:11469631-11469653 CTCAAGCAATCCCCCTGCCTCGG - Intronic
1036821718 8:11945333-11945355 CTCAGCCTCTCCCAGTAGCTAGG - Intergenic
1036937301 8:13015585-13015607 CTCAACCAGTCCACCTGCCTTGG + Intronic
1037288121 8:17322584-17322606 CTCAAGCAATCCTACTGCCTTGG - Intronic
1037342072 8:17856623-17856645 CTCAGCCTCTCCCAGTAGCTGGG - Intergenic
1038181882 8:25236830-25236852 CTCAACTTATCCACCTGCCTCGG + Intronic
1038241010 8:25807923-25807945 CTCACACTCTCCCACCGTCTGGG - Intergenic
1038323870 8:26555649-26555671 CTCAAGCTATCCACCTGCCTCGG - Intronic
1038464976 8:27753475-27753497 CTCAAGCTGTCCTCCTGCCTTGG - Intronic
1038754718 8:30329880-30329902 CTCAAGCACTCCTCCTGCCTTGG - Intergenic
1039175557 8:34800199-34800221 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
1039563700 8:38533806-38533828 CTCAACGTATCCTCCTGCCTTGG + Intergenic
1039611570 8:38923438-38923460 CTCAAATGATCCCACTGCCTTGG + Intronic
1039674389 8:39644519-39644541 CTCAAGCAGTCCTACTGCCTTGG + Intronic
1039880307 8:41621459-41621481 CTCAACATCGCCCCCAGCCTTGG + Exonic
1040075729 8:43227517-43227539 ATCATTCTCTCCCACTGCCTAGG - Intergenic
1040280036 8:46035953-46035975 CTCAAGCGATCCTACTGCCTCGG + Intergenic
1040448706 8:47522567-47522589 CTCACCCTCTCCTCCTGCCAAGG + Intronic
1040604309 8:48914727-48914749 CTCAAGTTATCCCCCTGCCTTGG - Intergenic
1041019651 8:53625979-53626001 CTCAAGCAATCCTACTGCCTTGG - Intergenic
1041289873 8:56298514-56298536 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1042938186 8:74081490-74081512 CTCAAGCTATCCATCTGCCTTGG + Intergenic
1043468375 8:80536690-80536712 CTCAACCTATCCACCGGCCTTGG + Intergenic
1043668142 8:82844492-82844514 GTTCACCTCCCCCACTGCCTAGG + Intergenic
1043874928 8:85475072-85475094 CTCAAACTATCCTCCTGCCTTGG - Intronic
1044264685 8:90167480-90167502 CTCAAGCTATCCACCTGCCTTGG - Intergenic
1044537542 8:93374614-93374636 TTCAATCTCTCCCACTTCCTTGG - Intergenic
1044804720 8:95993154-95993176 CTCAGCCTCTCCGAGTACCTGGG - Intergenic
1045011663 8:97964060-97964082 CTTCATCTCTCCCCCTGCCTTGG - Intronic
1045461153 8:102426895-102426917 CTCAAGCCATCCCCCTGCCTTGG + Intergenic
1045973268 8:108103662-108103684 CCCAACCCCTCACACTTCCTGGG - Intergenic
1046577590 8:116050373-116050395 CTCATCCACTCCCATGGCCTTGG - Intergenic
1046624010 8:116558192-116558214 CTCAAGCTATCCAACTGCCTTGG - Intergenic
1046964982 8:120153987-120154009 CACTACCTCCCCCACTGCATAGG - Intronic
1047461805 8:125072605-125072627 CTCAAGCTCTCCTCCTGCCTTGG + Intronic
1048348460 8:133596327-133596349 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1048598513 8:135892910-135892932 CTCAACCTCAGCATCTGCCTGGG + Intergenic
1048976404 8:139675276-139675298 TTCCACCTGCCCCACTGCCTGGG + Intronic
1049539497 8:143201493-143201515 CTCAACCTCTGGCTCTGGCTGGG + Intergenic
1049587831 8:143440197-143440219 CTCATCCCCTCCCGCTTCCTTGG - Exonic
1049766357 8:144357066-144357088 CTCAAGCTCTCCGGCTGCCACGG - Exonic
1049801370 8:144518960-144518982 CTAAACCTCTCCCTCTTCCCTGG - Intronic
1049857212 8:144870238-144870260 CTCTCCCTCTCTCTCTGCCTCGG + Intergenic
1050112273 9:2229175-2229197 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
1051845719 9:21449260-21449282 CCCCACCACTCCCCCTGCCTAGG - Intergenic
1052869075 9:33485816-33485838 CTCAAGCGATCCTACTGCCTTGG - Intergenic
1052920755 9:33965931-33965953 CTCAGCCTCCCCAAGTGCCTGGG - Intronic
1052951070 9:34212316-34212338 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1053941088 9:43249947-43249969 CTCAGCCTCTCCGAGTGCCTGGG - Intergenic
1054894028 9:70286948-70286970 CTCAAGCTATCCACCTGCCTTGG + Intronic
1055029817 9:71762385-71762407 CTCAAGCCATCCAACTGCCTCGG - Intronic
1055328724 9:75159957-75159979 CTCAAGCCATCCTACTGCCTTGG + Intergenic
1055476269 9:76666531-76666553 CTCTCCCTCTCTCTCTGCCTTGG + Intronic
1055758748 9:79583553-79583575 CCCAACCTCTCACTTTGCCTAGG - Intronic
1055904170 9:81273550-81273572 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1055982361 9:82016819-82016841 CTCAAGCTATCCACCTGCCTCGG + Intergenic
1056028095 9:82521800-82521822 CAAGACCTCTCCCACTCCCTTGG - Intergenic
1056164595 9:83928775-83928797 CTCAACTGATCCTACTGCCTCGG - Intergenic
1056486220 9:87060609-87060631 CTCAAACGATCCCCCTGCCTTGG + Intergenic
1056937329 9:90926201-90926223 CTCAAGCTATCCATCTGCCTTGG - Intergenic
1057038003 9:91825547-91825569 CCCACCTTCTCCCCCTGCCTGGG - Intronic
1057099391 9:92343710-92343732 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1057465441 9:95310127-95310149 CTCAAGCTGTCCTCCTGCCTGGG - Intronic
1058028212 9:100166273-100166295 CTCAACCCCTCATCCTGCCTAGG - Intronic
1058413252 9:104757816-104757838 CTCAAGCAATCCTACTGCCTTGG - Intronic
1058891715 9:109366669-109366691 CTCAAGCTATCCGCCTGCCTCGG + Intergenic
1058909182 9:109505510-109505532 CTCAAACAATCCTACTGCCTTGG + Intergenic
1059049650 9:110909980-110910002 CTCAAGCTATCCACCTGCCTCGG + Intronic
1059101601 9:111477343-111477365 CTCAACTTATCCCCCAGCCTCGG + Intronic
1059502023 9:114762948-114762970 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
1060111129 9:120907093-120907115 CTCAAGCGCTCCACCTGCCTCGG + Intronic
1060693998 9:125690382-125690404 CTCAACTTCTGCCATTCCCTTGG - Intronic
1060755914 9:126213301-126213323 CCCAGCAGCTCCCACTGCCTTGG + Intergenic
1060792971 9:126498215-126498237 CTCAGGCACTCCCACGGCCTCGG - Intronic
1060810660 9:126610097-126610119 CCCAACCTGGCCCACTGCTTGGG + Intergenic
1060897823 9:127229728-127229750 CTCAAGCTATCCTACTGCCTTGG + Intronic
1060912707 9:127363487-127363509 CTCAGCCAGTGCCACTGCCTGGG - Intronic
1061133732 9:128721929-128721951 CTCCTCCTGCCCCACTGCCTGGG - Intronic
1061162604 9:128903792-128903814 CTCAACCAATCCACCTGCCTTGG - Intronic
1061238112 9:129353706-129353728 CTCAAGCCATCCTACTGCCTTGG + Intergenic
1061245620 9:129400044-129400066 TTGAGCTTCTCCCACTGCCTTGG - Intergenic
1061308833 9:129749156-129749178 CTCAAGCAATCCCCCTGCCTTGG - Intronic
1061323103 9:129844390-129844412 CTCAACCAATCCATCTGCCTGGG - Intronic
1061339182 9:129965607-129965629 CTCAAGCGATCCCCCTGCCTCGG - Intronic
1061344649 9:130013211-130013233 CTCAAGCAATCCCCCTGCCTCGG + Intronic
1061385042 9:130284770-130284792 CTCCACCTCTCCCTCCTCCTGGG + Intronic
1062558014 9:137125076-137125098 CTCAGCCTCTCCGAGTACCTGGG - Intergenic
1062679067 9:137767054-137767076 CTCAAGCTATCCACCTGCCTTGG + Intronic
1203519690 Un_GL000213v1:34249-34271 CTGAACCTCCCCCAGGGCCTTGG - Intergenic
1185644445 X:1607395-1607417 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
1185780118 X:2836571-2836593 CTCAAGCTATCCTCCTGCCTTGG - Intronic
1185854298 X:3519983-3520005 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1186181393 X:6976461-6976483 CCCAACCTCTCGCACTTCCTGGG + Intergenic
1186224515 X:7383740-7383762 CTCAAGCGATCCCTCTGCCTTGG + Intergenic
1186380652 X:9055137-9055159 CTCATCCTTCCCCACGGCCTGGG - Intronic
1186597282 X:10997017-10997039 CTCAAGCAATCCCCCTGCCTTGG - Intergenic
1186793241 X:13019291-13019313 CTCAAGCGATCCCCCTGCCTTGG - Intergenic
1187334141 X:18367050-18367072 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
1187387801 X:18864287-18864309 CTCCCCCTCTCCCCATGCCTGGG + Intergenic
1187893134 X:23955946-23955968 CTCAAGCTATCCTTCTGCCTCGG + Intergenic
1188294322 X:28428960-28428982 CTCAAGCTATCCACCTGCCTTGG - Intergenic
1189401192 X:40670165-40670187 CTCGACATCCCACACTGCCTAGG - Intronic
1190012393 X:46796519-46796541 CTCAAGCTATCCACCTGCCTCGG + Intergenic
1190014399 X:46814351-46814373 CTCAAGCAGTCCCCCTGCCTTGG - Intergenic
1190085936 X:47395281-47395303 CTCAAGCTATCCTTCTGCCTTGG + Intronic
1190560148 X:51678944-51678966 CTCAAGCTTCCCGACTGCCTCGG - Intergenic
1190564143 X:51714377-51714399 CTCAAGCTTCCCGACTGCCTCGG + Intergenic
1190595673 X:52051152-52051174 CTCAACCAATCCTCCTGCCTCGG + Exonic
1190602474 X:52107021-52107043 CTCAAGCTGTCCTCCTGCCTTGG + Intergenic
1190613151 X:52202921-52202943 CTCAACCAATCCTCCTGCCTCGG - Exonic
1191153183 X:57242639-57242661 CTCAACCCCTTGCACTTCCTGGG - Intergenic
1191705048 X:64085580-64085602 CTCAACCCCTTGCACTTCCTGGG - Intergenic
1191907772 X:66112394-66112416 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1192125847 X:68499871-68499893 CTCAAGCTATCCTCCTGCCTCGG + Intronic
1192343954 X:70285958-70285980 CTCAAGCTATCCATCTGCCTTGG + Intergenic
1192462657 X:71330582-71330604 CTCAAGCAGTCCTACTGCCTTGG + Intergenic
1193255282 X:79341747-79341769 CTCAAGCTCTCCTCCTGCCTTGG + Intergenic
1193267782 X:79494025-79494047 CTCAACCCCTCACACTCCCCGGG - Intergenic
1193798362 X:85905140-85905162 CTCACCTGCTCCCACTCCCTTGG + Intronic
1194189830 X:90821264-90821286 CTCAAGCAATCCTACTGCCTTGG - Intergenic
1194192093 X:90849808-90849830 CTCAACTTATCCATCTGCCTTGG - Intergenic
1194940889 X:100008831-100008853 CTCAACACCTCCCAATGCCTAGG + Intergenic
1195110465 X:101643037-101643059 CTCAAGCTATCCTTCTGCCTTGG + Intergenic
1195222651 X:102761429-102761451 CTGAACATCCCCCAATGCCTAGG + Intergenic
1195410879 X:104566921-104566943 TTCAGCCACTCCGACTGCCTGGG + Exonic
1195414151 X:104602213-104602235 CCCAACCTCTTGCACTTCCTAGG - Intronic
1195712295 X:107783247-107783269 CTCAAGTGATCCCACTGCCTCGG - Intronic
1195768194 X:108319141-108319163 CTCAAGCGATCCCCCTGCCTTGG - Intronic
1196279878 X:113811834-113811856 CTCAGCCTCTCCCAGTAGCTGGG - Intergenic
1196377544 X:115050702-115050724 CTCAAGCGATCCCTCTGCCTCGG + Intergenic
1196928874 X:120661339-120661361 CTCAAGCTATCCTCCTGCCTCGG - Intergenic
1197186127 X:123589306-123589328 CTCAAGCTATCCACCTGCCTCGG - Intergenic
1197358302 X:125465303-125465325 CTCAAGCAATCCCCCTGCCTTGG + Intergenic
1197874854 X:131091781-131091803 CTCAACCACTCCCAGTCACTTGG + Intergenic
1197935110 X:131732558-131732580 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1197937765 X:131757508-131757530 CTCAAGCTGTCCACCTGCCTTGG - Intergenic
1197956727 X:131958593-131958615 CTCAAGCACTCCTCCTGCCTTGG - Intergenic
1198157711 X:133978164-133978186 CTCAAGCAATCCCCCTGCCTCGG + Intronic
1198204672 X:134454447-134454469 CTCAAGCGATCCTACTGCCTTGG + Intergenic
1198207381 X:134479840-134479862 CTCAAACAATCCAACTGCCTTGG + Intronic
1198407943 X:136333749-136333771 CTCAAATTCTCCACCTGCCTTGG + Intronic
1198535500 X:137582187-137582209 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1198892977 X:141420188-141420210 CTCAAGCTATCCTGCTGCCTTGG - Intergenic
1200059362 X:153477336-153477358 CTCCGCCCCTCCCCCTGCCTGGG - Intronic
1200327131 X:155252668-155252690 CTCAAGCTATCCTCCTGCCTTGG + Intergenic
1200536411 Y:4403165-4403187 CTCAAGCAATCCTACTGCCTTGG - Intergenic
1200809196 Y:7464513-7464535 CTCAAGCTATCCTCCTGCCTTGG - Intergenic
1201225561 Y:11815269-11815291 CTCAAGCTGTCCTCCTGCCTTGG - Intergenic
1201863921 Y:18629418-18629440 CTCAAGCGATCCTACTGCCTGGG + Intergenic
1201869401 Y:18690960-18690982 CTCAAGCGATCCTACTGCCTGGG - Intergenic
1202114580 Y:21458464-21458486 CTCTACCTCTACAAATGCCTTGG + Intergenic
1202305150 Y:23461336-23461358 CTCAAGCTATCCCCCTGCCTTGG - Intergenic
1202565659 Y:26209253-26209275 CTCAAGCTATCCCCCTGCCTTGG + Intergenic