ID: 1136631941

View in Genome Browser
Species Human (GRCh38)
Location 16:31493932-31493954
Sequence GTCTCCTGGAAAATGGCAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 282}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136631933_1136631941 -4 Left 1136631933 16:31493913-31493935 CCCCGCCAGGTTCACCAGCGTCT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 282
1136631930_1136631941 27 Left 1136631930 16:31493882-31493904 CCAGAGGGAGCATCAGGAGGCTG 0: 1
1: 0
2: 1
3: 25
4: 289
Right 1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 282
1136631935_1136631941 -6 Left 1136631935 16:31493915-31493937 CCGCCAGGTTCACCAGCGTCTCC 0: 1
1: 0
2: 2
3: 19
4: 332
Right 1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 282
1136631936_1136631941 -9 Left 1136631936 16:31493918-31493940 CCAGGTTCACCAGCGTCTCCTGG 0: 1
1: 0
2: 2
3: 25
4: 495
Right 1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 282
1136631934_1136631941 -5 Left 1136631934 16:31493914-31493936 CCCGCCAGGTTCACCAGCGTCTC 0: 1
1: 0
2: 1
3: 18
4: 311
Right 1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 282
1136631932_1136631941 3 Left 1136631932 16:31493906-31493928 CCAAGAGCCCCGCCAGGTTCACC 0: 1
1: 0
2: 3
3: 24
4: 271
Right 1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG 0: 1
1: 0
2: 1
3: 25
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136631941 Original CRISPR GTCTCCTGGAAAATGGCAGA GGG Exonic
900163497 1:1235595-1235617 GTCCCCAGGAAGAGGGCAGAAGG - Intergenic
901249671 1:7767127-7767149 GTCTTGTGGAAATTTGCAGAGGG + Exonic
901461413 1:9394081-9394103 CTCTCCTGGACACTGGCAGGGGG - Intergenic
902481442 1:16714143-16714165 GTCTCAAGGAAAAGGGCAGCAGG + Intergenic
902514210 1:16980993-16981015 GTGTCCTGGAAGCTGGGAGAAGG - Intergenic
902942621 1:19811562-19811584 GTCACCTGTAAAGTGGCAGGTGG - Intergenic
905317384 1:37092100-37092122 GTCTCTTGGGACAAGGCAGAAGG - Intergenic
908253105 1:62280655-62280677 GTCCCCAGGAAACTTGCAGAAGG - Intronic
908739076 1:67308314-67308336 GGCGACTGGAAAAGGGCAGAGGG + Intronic
911527250 1:99002889-99002911 GTCTCCTGGAAAACTGTACATGG + Intronic
913029653 1:114887781-114887803 CTCTACTGGCAAATGACAGAGGG - Intronic
914744465 1:150491580-150491602 TTATCCTGGAAAAAGGTAGAAGG - Exonic
916942961 1:169695302-169695324 CTCACCTGGAAACTGGCGGATGG - Intronic
917032860 1:170714089-170714111 GTGTCCTGATAAATGGCACATGG - Intronic
917124884 1:171678298-171678320 TGCTCCTGAGAAATGGCAGATGG + Intergenic
918963662 1:191311938-191311960 CTCTTCTGAAAACTGGCAGAAGG + Intergenic
918974648 1:191467593-191467615 GACTCCTCTAAAATGGCATATGG - Intergenic
919435613 1:197555952-197555974 GTCTGCTGGTAAAAGGCAGCTGG - Intronic
919830588 1:201538258-201538280 GTCTGCAGGAAGAAGGCAGAAGG - Intergenic
920775115 1:208928549-208928571 GTCACCAGAAAAATGACAGAGGG - Intergenic
921049678 1:211502050-211502072 GGCTGCTGGAAATTGCCAGAAGG + Intergenic
923356384 1:233160155-233160177 GTACACTTGAAAATGGCAGATGG - Intronic
924015890 1:239722195-239722217 GTCACCTGGAAAATGCTAAAGGG + Intronic
1063446830 10:6123716-6123738 TTCTCTTGGAAAAAAGCAGAAGG + Intergenic
1064209992 10:13353504-13353526 GCCTCCTGAAAAGTGGAAGAGGG + Intergenic
1065759328 10:28967257-28967279 GTCTCCTGAAAAATGACATAAGG - Intergenic
1067151233 10:43736587-43736609 GTCTCCTGGAACATGCCACCAGG - Intergenic
1067993634 10:51243869-51243891 TTAACCAGGAAAATGGCAGAAGG - Intronic
1068343381 10:55738322-55738344 GCCTCCAGGAGAATGGCAGGCGG + Intergenic
1069721304 10:70551226-70551248 GACTTCTGGAAATTGGCAGCTGG + Intronic
1069960080 10:72074281-72074303 GCCTCCTGGACAAAGGCCGAAGG + Intronic
1070748000 10:78946513-78946535 GGCTCCAGGACAAGGGCAGAAGG + Intergenic
1073805652 10:107094951-107094973 ATCTTCTGGAACATGGGAGAAGG + Intronic
1076512866 10:131024871-131024893 GTCTCCAGGAACAAGGCAGATGG - Intergenic
1077035307 11:491573-491595 CCCTCCTGGAGAATGGGAGAGGG - Intergenic
1080052898 11:27874847-27874869 TTCATCTGGAAAATGGGAGATGG - Intergenic
1083142118 11:60730545-60730567 GTCTCATGGCAATTGCCAGAAGG - Intronic
1083429205 11:62605176-62605198 GTCTCCTGGGAGAGGGGAGAAGG + Exonic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1086491655 11:87362278-87362300 GTCTCCTGGCAATGTGCAGAAGG + Intergenic
1086975474 11:93127754-93127776 GTCGCCTTAAAAATGTCAGAGGG - Intergenic
1087262725 11:96028739-96028761 GTGTTCTGAAAAAGGGCAGAGGG + Intronic
1088091202 11:106041889-106041911 ATCACCTGGAAAAAGGCAGTTGG - Intergenic
1090395858 11:126417559-126417581 GCATCGTGGAAAATGCCAGAGGG + Intronic
1090593720 11:128298095-128298117 GTCTCCTGAAAAAGGGCAAATGG + Intergenic
1091398350 12:168134-168156 GTCTCCTGGAAAAGAGAAGCGGG + Intronic
1092021603 12:5207227-5207249 GTCACCTGGCAATTGACAGAGGG + Intergenic
1092259760 12:6946524-6946546 GTCTCCAGGAAAAGGACAGGTGG - Intronic
1093100437 12:15022099-15022121 ATATCCTGTAAAATGACAGAAGG - Intergenic
1094412838 12:30185754-30185776 TTCTCCTGGAAAATAGGAAAGGG + Intergenic
1096515919 12:52155260-52155282 ACCTCCTGGAAAAAGGAAGATGG - Intergenic
1097334102 12:58363061-58363083 AACAACTGGAAAATGGCAGAGGG + Intergenic
1097750220 12:63344502-63344524 GACCCCTGGAGAATGACAGAAGG + Intergenic
1098936930 12:76490754-76490776 ATCTCATGCAAAAAGGCAGAGGG + Intronic
1098962669 12:76755107-76755129 GTGCCCTGGAACATTGCAGACGG + Intergenic
1100103074 12:91133569-91133591 TTCAGCTGGCAAATGGCAGATGG - Intergenic
1102565800 12:113796774-113796796 GACTCCTGGACAAAGGCACATGG - Intergenic
1103002217 12:117393857-117393879 GTGCCCTGGAAAGTGACAGAAGG + Intronic
1103919364 12:124391372-124391394 TTCTCGGGGAAAATGGCAGGTGG - Intronic
1107441503 13:40431443-40431465 GTTTCCTGGAAAATTCCAGATGG + Intergenic
1108528627 13:51307555-51307577 GTGTCCTTAAAAGTGGCAGAAGG + Intergenic
1108950242 13:56083610-56083632 GTATCCGAGAAAATAGCAGAAGG + Intergenic
1109908252 13:68874448-68874470 GTCCCCTAGAATATGGCAAAAGG + Intergenic
1110005687 13:70264578-70264600 GGCTTTTGGAAAATGTCAGAAGG + Intergenic
1111932277 13:94524470-94524492 GTCTCCAGGCCAGTGGCAGAGGG - Intergenic
1112132214 13:96536696-96536718 TTATCCTGAAAAATGGTAGAGGG - Intronic
1112483166 13:99795879-99795901 TTCCCCTGCAAAATGGCAGGGGG - Intronic
1113232293 13:108226215-108226237 GTCTAGTGGAAAATGACACAAGG + Intronic
1114217483 14:20667667-20667689 TTCTCCTGGAAAGCAGCAGACGG - Intergenic
1114822916 14:26043174-26043196 GTTACCTGGAACATGGCAGGTGG + Intergenic
1115947987 14:38685236-38685258 AAGTTCTGGAAAATGGCAGAGGG - Intergenic
1115961277 14:38837807-38837829 CTCTCCTGGGAAATGGCTCAGGG - Intergenic
1118324583 14:64772533-64772555 GGCTCCTGGAAATTGGTAGCAGG + Intronic
1120090359 14:80324811-80324833 ATTTCCTGGAAAATAGAAGATGG - Intronic
1120302577 14:82726976-82726998 TTCTCCTGGAAAAGGGCATAAGG - Intergenic
1120846272 14:89128479-89128501 GCCTGGTGCAAAATGGCAGATGG - Intronic
1122706593 14:103625771-103625793 GGGGCCTGGCAAATGGCAGAAGG + Intronic
1123049457 14:105533712-105533734 GCCTCCTGGGTAATGGCAGAGGG - Intergenic
1124402369 15:29360737-29360759 CTCTCCTGGAACATAGCAGCAGG + Intronic
1124866925 15:33501260-33501282 TTCTCCTTCAAAATGGCTGATGG + Intronic
1125211561 15:37222035-37222057 GTCTCCCCCAAAATGGCTGACGG + Intergenic
1126302571 15:47214836-47214858 TTATTCTAGAAAATGGCAGATGG + Intronic
1126853370 15:52812991-52813013 ATCTCCTGGCAAAAGGCAGAAGG - Intergenic
1127370263 15:58332420-58332442 GCCTCATGGAAGAGGGCAGAAGG - Intronic
1127698523 15:61474705-61474727 TTTTCCTGGTAAAAGGCAGAGGG + Intergenic
1127900812 15:63339539-63339561 GTCACCTGGTAAATGGCAGCAGG - Intronic
1128673926 15:69595149-69595171 GTCCCCTGGGAAAGGACAGAGGG + Intergenic
1128844745 15:70881599-70881621 TTTTCCTGGTGAATGGCAGACGG + Exonic
1129184898 15:73899993-73900015 TTCTCCTGGAGACAGGCAGAGGG - Intergenic
1130399191 15:83533371-83533393 TTCTATTGTAAAATGGCAGAAGG + Intronic
1131031348 15:89188489-89188511 TTCTCCTGGAAAATAGGAAAAGG + Intronic
1131931631 15:97449090-97449112 GCCTCATGCAAAAAGGCAGAGGG + Intergenic
1132530251 16:444302-444324 TTCTCCTTGTAAAGGGCAGAGGG + Intronic
1133166771 16:3953512-3953534 GTCTTCTGGAAAAGAGAAGATGG + Intronic
1133477712 16:6139397-6139419 GTCTCCTGGAACATCCCACATGG - Intronic
1133502641 16:6380170-6380192 GCCACATGGAAAATGGGAGAAGG + Intronic
1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG + Exonic
1136363117 16:29794270-29794292 CTCATCTGGAAAATGGGAGACGG + Intronic
1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG + Exonic
1137508867 16:49080782-49080804 TTCTCCAGGAAGATAGCAGAAGG + Intergenic
1137856715 16:51802072-51802094 GTCTCCTGGTGAAAGGCAGAAGG + Intergenic
1138807530 16:60108241-60108263 TTCACCTGGAAAATGGGAAACGG + Intergenic
1138837669 16:60458280-60458302 GAGTCATGGAAAATGGCAAAAGG - Intergenic
1139660673 16:68418783-68418805 GTCTCCTTGTAAATGTCAGGTGG + Intronic
1140689959 16:77472555-77472577 CTCTCCTGTAAAATGGCATAAGG + Intergenic
1141264825 16:82487494-82487516 GTCTCCTGAAAAATGCCAATGGG + Intergenic
1142093168 16:88225970-88225992 GGCTCCTTGCACATGGCAGAAGG + Intergenic
1142116021 16:88356600-88356622 GTCTGCTGGGAGCTGGCAGATGG - Intergenic
1142159574 16:88550163-88550185 GTCTTCTGGAAGATGGCAATGGG - Intergenic
1142992886 17:3743484-3743506 GTCACCTGGAAGATGGCAAAGGG + Exonic
1143156191 17:4838140-4838162 TTCCCCTGGAAAATTGCAAAAGG + Intronic
1147513480 17:41094169-41094191 GCCTCATGCAAAAAGGCAGAGGG + Intronic
1148489139 17:48012122-48012144 GTCTCCTGCAAAAGGGGAAAAGG - Intergenic
1149265254 17:54921124-54921146 CTCTACTGGAGATTGGCAGATGG + Intronic
1149757228 17:59197544-59197566 CACTCCTGGAAAAAGTCAGATGG + Exonic
1156722793 18:40090563-40090585 GACATCTGGAAAATGGAAGAGGG + Intergenic
1156842436 18:41625465-41625487 TACTCCTGGAAAATGGAAAATGG - Intergenic
1159016523 18:63105460-63105482 GTTTCCTGGAAGATGCCAGAGGG + Intergenic
1159390911 18:67790622-67790644 TTCTTGTGGAAAATGGCACATGG + Intergenic
1159419885 18:68204581-68204603 GTCTCCTTGAAGCTGGCTGAGGG + Intergenic
1160129204 18:76209325-76209347 GTCTCTTGGAGAAGGGAAGAAGG + Intergenic
1160385863 18:78495824-78495846 GTCTCCTGGAAGAGGGGAGCCGG - Intergenic
1160712144 19:557106-557128 GTCCCGTGGTAAATGCCAGAAGG + Intergenic
1161606276 19:5216563-5216585 GGCTCCTGGAAGAGGGCAGGGGG - Intronic
1162108986 19:8390190-8390212 GTGTCCTGGAGAAAGGCGGAAGG - Exonic
1163361107 19:16846951-16846973 CTTTCCTGAAAACTGGCAGAAGG + Exonic
1164499143 19:28798919-28798941 CACTCCTGGAAAATTTCAGAGGG - Intergenic
1164723675 19:30451146-30451168 GGCTCCTGGGGAATGTCAGATGG + Intronic
1165066315 19:33230872-33230894 CTCACTTGGACAATGGCAGATGG + Intergenic
1165127172 19:33606642-33606664 ATTTCCTGCAAATTGGCAGATGG + Intergenic
1166573404 19:43814139-43814161 GGCTCCTGGGAAATGGCCCATGG - Intronic
1167077968 19:47260570-47260592 TTCTCCTGGAAGAGGGGAGATGG - Exonic
1167652630 19:50741337-50741359 TTGACCTGCAAAATGGCAGAAGG - Intergenic
1202715481 1_KI270714v1_random:40054-40076 GTCTCAAGGAAAAGGGCAGCAGG + Intergenic
926582545 2:14647067-14647089 GTCTCCTGTTAAAAGGCTGAGGG - Intronic
927143109 2:20142978-20143000 GTCTACTGAACAAGGGCAGATGG + Intergenic
927459311 2:23284340-23284362 GTCACCTGGATCATGGAAGAAGG + Intergenic
930034489 2:47076885-47076907 GTGTCCTGGAAAGTGGCACGTGG - Intronic
930991033 2:57655039-57655061 CTCCCCTGGTGAATGGCAGAGGG + Intergenic
932840084 2:75073724-75073746 GTTTCCCGGCAAATGGCAGGAGG - Intronic
936162441 2:110094755-110094777 GGCTCCTAGAATATGCCAGAGGG + Intronic
936182219 2:110276611-110276633 GGCTCCTAGAATATGCCAGAGGG - Intergenic
937642732 2:124231771-124231793 GGCTCCTGTTAAATAGCAGAAGG - Intronic
938095620 2:128460070-128460092 ATGTCATGGAAAATGGCACAAGG + Intergenic
938698526 2:133855953-133855975 GTCTCATGGGAAATGTCTGAAGG + Intergenic
940083079 2:149827020-149827042 GGCTCCTGGAAAATTAAAGATGG - Intergenic
941215127 2:162697245-162697267 GTTTCCTGCAAGGTGGCAGATGG - Intronic
942092899 2:172511330-172511352 TTCACCTGTAAAATGGCATAAGG + Intergenic
942375486 2:175332161-175332183 GTCCCATGGAAAATTGCAGACGG + Intergenic
942508827 2:176673860-176673882 GTCACCTGTAAGATGGGAGAAGG + Intergenic
944151682 2:196565988-196566010 GTTTCCTGGTAATTGGCTGAGGG - Intronic
944454397 2:199878359-199878381 GCCTCATGCAAAAAGGCAGAGGG - Intergenic
944615820 2:201459106-201459128 GACTCCTGGAAAATGGCAGGAGG - Intronic
945446092 2:209940260-209940282 ATTTCCTGGAAAGGGGCAGAAGG + Intronic
948380515 2:237547238-237547260 GTGTGCTCGAAAATGGCACAGGG + Intronic
948425263 2:237883228-237883250 GTATCTTGGTATATGGCAGAGGG + Intronic
1169216922 20:3799569-3799591 GTCTCCTGTAACACGGCTGAGGG + Intronic
1170180910 20:13529006-13529028 GTTTCCTGGAGCATGGCAGGAGG - Intronic
1172138406 20:32703862-32703884 CTCTCCTGAAAGATGGCACAAGG - Intronic
1172216991 20:33242608-33242630 TTCTCCTGGTAGAAGGCAGACGG + Intronic
1172270595 20:33653660-33653682 GGGGCCTGCAAAATGGCAGACGG - Intergenic
1172675773 20:36670669-36670691 ATCTGAAGGAAAATGGCAGATGG - Intronic
1175521965 20:59607688-59607710 GTTGCTTGGAAAATGGCATATGG + Intronic
1175907813 20:62390172-62390194 GTCTCCTGGTGAGAGGCAGAGGG + Exonic
1177297067 21:19188979-19189001 ATTTCATGGAAACTGGCAGAAGG + Intergenic
1180076064 21:45463544-45463566 GTACTCTGGTAAATGGCAGATGG - Intronic
1181684609 22:24519889-24519911 CTCTCCTGGTGAATGCCAGAAGG - Intronic
1182145191 22:27993148-27993170 GTGTCCTGAGAAATGGCAGGGGG - Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1184039557 22:41934916-41934938 GTCTCCTGGACAATGTCACTGGG + Intergenic
1185304774 22:50108720-50108742 GACTCCTTGAAACTGCCAGATGG + Exonic
949840997 3:8319835-8319857 GTCATGTGGAAAATGGAAGATGG - Intergenic
950712994 3:14827101-14827123 CTCACCTGGAAAATGGGAGCTGG - Intronic
951475069 3:23096308-23096330 GTCTCTTGGAACAAGGTAGAAGG - Intergenic
955563945 3:60224187-60224209 GTCTTCTGGAAGATAGCGGAAGG - Intronic
957827790 3:85471214-85471236 ATATCCTGGAATATGGTAGAGGG - Intronic
958704234 3:97633733-97633755 GTTTCCTTGAATATGGTAGATGG - Intronic
959003257 3:100989541-100989563 GACTCTTGGGATATGGCAGAGGG - Intronic
960521767 3:118663150-118663172 TTCTCCTGGAAAATGGAAAATGG + Intergenic
963815318 3:149824388-149824410 GTGTCCTTAAAAATGGAAGAGGG + Intronic
965379128 3:167966714-167966736 TGCTGCTGGAAAATGGGAGAGGG - Intergenic
966789579 3:183654833-183654855 GTTTCCTGGAAACTGGAAGTTGG + Intronic
967109451 3:186280740-186280762 ATCTCCTAGAAAATAGCAAAGGG + Exonic
967365113 3:188677614-188677636 TTCTGCTGGGAAATGGGAGAGGG + Intronic
967536584 3:190611319-190611341 ATCTCCTGCAAAATGACAGTGGG - Intronic
969095071 4:4726678-4726700 GCCTCCTGGGAAAAGCCAGAAGG - Intergenic
969591090 4:8122307-8122329 GTCCCCTGGGAAATGGAGGATGG - Intronic
970567726 4:17348859-17348881 GTATAGTGGAAAATGTCAGATGG - Intergenic
970601954 4:17647664-17647686 GTCTCCTGGACACTGGCTGCTGG + Exonic
971192713 4:24443007-24443029 CGCTCCTAGGAAATGGCAGAAGG - Intergenic
971450235 4:26793248-26793270 TTCTCATGGAAAATGGCACCAGG + Intergenic
973319437 4:48794994-48795016 GTCTGCAGAAAAATGGGAGAGGG - Intergenic
973539198 4:51919039-51919061 CTCTGCTGGAAAGTGTCAGAGGG - Intergenic
981148999 4:141359603-141359625 ATCTCCTGTAAACTGGCAGCTGG + Intergenic
981154485 4:141417655-141417677 GCCTGCTGGACAAGGGCAGAGGG + Intergenic
981618989 4:146672688-146672710 GTCTCTGGGAAAAAAGCAGAGGG + Intergenic
981825444 4:148935444-148935466 AGCTGCTGGAAAATTGCAGAAGG + Intergenic
983563672 4:169127043-169127065 ATCTTCTGCATAATGGCAGAAGG - Intronic
984864752 4:184272014-184272036 GTCCCTGGGAAAATGGCAAAGGG + Intergenic
986485183 5:8229025-8229047 GTCTCTTGGAAGATGGCCGATGG - Intergenic
986865731 5:11984383-11984405 GTCAACTGGAAAATGACACATGG + Intergenic
987031736 5:13982773-13982795 GCCTCTTGCAAAAAGGCAGAAGG - Intergenic
987829458 5:23076686-23076708 GGCTCATGGACAGTGGCAGATGG - Intergenic
988565183 5:32314952-32314974 GTCACCTGGAAACTGGGATAAGG - Intergenic
990128436 5:52548513-52548535 GCCTCATGCAAAAAGGCAGATGG + Intergenic
990644752 5:57831585-57831607 GTGTACTGGAAAATGGAAGCAGG + Intergenic
994433491 5:99698546-99698568 GTATCCTGGAAGATAGCATAAGG - Intergenic
996962669 5:129269977-129269999 ATCTCCTTGAAAAAAGCAGAGGG - Intergenic
998760847 5:145430054-145430076 GTCTCATGGGAAATAGTAGATGG + Intergenic
999660813 5:153860948-153860970 GTCTCCTGAACAATAGCACAAGG + Intergenic
999776206 5:154814663-154814685 TTCTCCCAGAAGATGGCAGAAGG - Exonic
1000118659 5:158176348-158176370 GTTTCCTGGACAATGGCCGCAGG - Intergenic
1001221898 5:169907679-169907701 CACAGCTGGAAAATGGCAGAGGG + Intronic
1002848373 6:968845-968867 GGCTCTGGGAAGATGGCAGAGGG + Intergenic
1003643117 6:7892273-7892295 GTTTCCTGGAAATTGGTAGTTGG - Intronic
1004150972 6:13119838-13119860 GATTCCTGGAAAATGACACAGGG - Intronic
1004511924 6:16290293-16290315 TCCTCCTGGAAAAAGGGAGAAGG - Intronic
1005236346 6:23766092-23766114 GTCACATGGAAAATGGATGAAGG + Intergenic
1005471316 6:26164881-26164903 TTCTCCCAGAAGATGGCAGAAGG - Intronic
1006470264 6:34224557-34224579 GCCTCGTGGAGTATGGCAGAAGG + Intergenic
1007292698 6:40799284-40799306 TTCTCCTGGTGAATGGAAGAGGG + Intergenic
1007375005 6:41450648-41450670 GTCTCCGATAAAATGACAGATGG - Intergenic
1008159387 6:48059001-48059023 GTCTTCCGGATAAGGGCAGAAGG + Intronic
1008514660 6:52307546-52307568 GAATCCGGGAAAAGGGCAGATGG - Intergenic
1009981233 6:70728217-70728239 GTCTCCTAGCAAATGGAAAAGGG + Intronic
1010631321 6:78201629-78201651 TTCTGCTTGAAAATGGCAGAAGG - Intergenic
1011294422 6:85810853-85810875 ACCTCATGCAAAATGGCAGAGGG - Intergenic
1013211216 6:107988642-107988664 CTCTCCTGGAAAAAGGGAAAGGG - Intergenic
1014020009 6:116575893-116575915 ATTTCCTGGAAACTGTCAGAGGG + Intronic
1014893759 6:126874078-126874100 ATCTCATGGCAAAAGGCAGAAGG - Intergenic
1015726553 6:136305497-136305519 CTCTCCTGGAAGAAGGAAGAAGG - Intergenic
1016570044 6:145501756-145501778 ATCTCGTAGAAGATGGCAGATGG - Intronic
1017597129 6:156041189-156041211 TTCTTCTGGAAAATAGAAGAGGG + Intergenic
1020937132 7:14480525-14480547 GTCTCTTGAAAAATGGCTGCTGG - Intronic
1021040461 7:15855842-15855864 CTCTCCTGGATAGTAGCAGAGGG + Intergenic
1022203927 7:28144840-28144862 ATCTGCTGGAAAATGGCACTTGG + Intronic
1022496321 7:30855197-30855219 CTCATCTGGAAAATGGAAGATGG + Intronic
1022679595 7:32531929-32531951 GCCTCATGCAAAAAGGCAGAGGG - Intronic
1024409505 7:49023965-49023987 GTCATCTGGTAGATGGCAGAGGG + Intergenic
1026772750 7:73212615-73212637 CTCTCCTGGGAAGTGGCACAGGG + Intergenic
1027291562 7:76717589-76717611 GTCTTCTAGAAAATAGAAGAGGG - Intergenic
1029226994 7:99035399-99035421 GTGTGCTAGAAAATGGCATAAGG - Intronic
1030563390 7:111120059-111120081 GCCTGCAGGAAAATGGCAGACGG + Intronic
1030981683 7:116192541-116192563 GTCTTCTGACAAATGGCAGATGG + Intergenic
1031640883 7:124162100-124162122 GTCTCAGGGAAAGGGGCAGAAGG - Intergenic
1031725001 7:125227606-125227628 AACTCCTGGAAAATAGCATAGGG - Intergenic
1032248348 7:130231925-130231947 GCCTCATGCAAAAAGGCAGAGGG - Intergenic
1033068611 7:138180590-138180612 GTCTCCTGAAAAATAGCCGATGG + Intergenic
1033233410 7:139619494-139619516 ATTTCCAGGAAATTGGCAGAAGG - Intronic
1033245257 7:139712399-139712421 GTCCCATGCAAAATGACAGAGGG + Intronic
1034237741 7:149585805-149585827 GTTTCCAGGCAAATGGCTGAAGG + Intergenic
1034267324 7:149787525-149787547 GTCTCCTGGCTCAGGGCAGAGGG - Intergenic
1034540609 7:151755721-151755743 GTTTCCTGTAAAAAGCCAGATGG - Intronic
1036039588 8:5060552-5060574 CTCTCCTGGAAAATGGGACCTGG + Intergenic
1037863129 8:22420522-22420544 GTCTCTTAGAAGATGGCAGTGGG - Exonic
1037932017 8:22886874-22886896 GTCTCCTGGGTAAGGTCAGAGGG + Intronic
1039773371 8:40711488-40711510 GTCCTCTGAAAATTGGCAGATGG - Intronic
1040392426 8:46961552-46961574 GTCTCCTGGAAAATGGCTTGTGG - Intergenic
1040908267 8:52491380-52491402 GCCTCATGCAAAAAGGCAGAGGG - Intergenic
1041135923 8:54758948-54758970 GTCGCTTGGAAAACTGCAGAAGG + Intergenic
1042224840 8:66507389-66507411 TTCTTCTGGAAATTGGCAGAGGG - Intronic
1043433709 8:80218535-80218557 ATCCCCTGGTAAAAGGCAGAAGG + Intronic
1043580518 8:81707282-81707304 ATCTCCAGGAGAATGGCAAAGGG + Intronic
1044478476 8:92656437-92656459 GTCTCCTGGCAATGGGCTGAGGG + Intergenic
1045441253 8:102214263-102214285 AACTTCTGGAAAATGGAAGAGGG + Intronic
1045475874 8:102551744-102551766 GTCTCTTGGACAGTGTCAGAAGG + Exonic
1046005911 8:108483368-108483390 GTTGACTGCAAAATGGCAGAAGG - Intronic
1046581459 8:116098186-116098208 TTCTCGTGGCAGATGGCAGAAGG - Intergenic
1046599070 8:116296735-116296757 GTAACCTGGAAAATGGCAGGAGG + Intergenic
1046884404 8:119348015-119348037 ATCTCCTGGAAAATAACATAGGG - Intergenic
1047330917 8:123886029-123886051 GTCTCAAGGCAAATGGCAAAGGG - Intronic
1048502646 8:134992749-134992771 CTATCCTGGACAAGGGCAGATGG - Intergenic
1049040608 8:140109982-140110004 GTCTCTTGGAACACAGCAGAGGG - Intronic
1050330457 9:4540429-4540451 GTCTCATGCAAAAAGGCAGAGGG + Intronic
1050494885 9:6230342-6230364 GGGTCCAGGAAAGTGGCAGATGG + Intronic
1051141523 9:13984513-13984535 GTCAACTGGAAAATCCCAGATGG - Intergenic
1051896321 9:21993665-21993687 CTCTCCTGGAAGGTGGGAGAGGG + Intronic
1052169650 9:25377468-25377490 GCCTCGTGCAAAAGGGCAGAGGG - Intergenic
1053149893 9:35736691-35736713 CTGTCCTGCAAAATGACAGAGGG - Exonic
1055112598 9:72574576-72574598 ATCAACTGGAAAATGTCAGAGGG + Intronic
1055237835 9:74145604-74145626 GGCTGCTGGATAAGGGCAGAGGG - Intergenic
1056132289 9:83598542-83598564 TGTTCCTGGAAAATTGCAGAGGG + Intergenic
1056283574 9:85065473-85065495 GTCTACTGGCACATGACAGAAGG + Intergenic
1057311641 9:93946796-93946818 ATCTTCTGGAAAATGGGAGCAGG + Intergenic
1057423265 9:94928710-94928732 GTCACCAGGAAAATGACGGAAGG - Intronic
1058414424 9:104771367-104771389 GTCTACTTGAGAATGGAAGATGG - Intronic
1059940790 9:119357714-119357736 ATCTCCTGGAATATGAAAGATGG + Intronic
1060489600 9:124072994-124073016 GGCTCCCGGAAAAGGGCAGAAGG - Intergenic
1061590396 9:131594139-131594161 GTGCCCTGGATTATGGCAGATGG + Intronic
1061613663 9:131764987-131765009 GTCTCATGGAAAACTCCAGAGGG - Intergenic
1062511440 9:136908341-136908363 GTCTCCAGGGAAAGGGCCGAGGG - Intronic
1186034593 X:5408040-5408062 ATCCCCTGGAAATTTGCAGAAGG - Intergenic
1186332789 X:8553951-8553973 GTCTACTGGAAGAAGACAGAAGG - Exonic
1187519583 X:20001855-20001877 GTCCCCTTGCAAAAGGCAGAGGG - Intergenic
1189791735 X:44611463-44611485 ATGTCTTGCAAAATGGCAGATGG + Intergenic
1190277191 X:48906387-48906409 CTCACCTGGAAAGTGGCAGCTGG + Exonic
1190981888 X:55463680-55463702 GTCTACTGAGAAAGGGCAGAGGG - Intergenic
1190986810 X:55509500-55509522 GTCTACTGAGAAAGGGCAGAGGG + Intergenic
1191104976 X:56767141-56767163 GGCTACTGGAAAACGGCAGAAGG - Intergenic
1191840084 X:65506976-65506998 TTCTCCTGGAAACTAGCAGGGGG - Exonic
1194804595 X:98311754-98311776 ATGTCCTGTAAAATGGAAGAGGG + Intergenic
1195118232 X:101721701-101721723 GCCTCCTGGAGAATGGGAAATGG + Intergenic
1195220056 X:102738211-102738233 CTCTCTTCGCAAATGGCAGATGG - Intronic
1195654000 X:107316960-107316982 GTCACCTGGAGAATGCCAGTTGG - Intergenic
1197626665 X:128809669-128809691 TTATCCAGTAAAATGGCAGAGGG + Intergenic
1198070961 X:133148165-133148187 CTTTCCTGGGAACTGGCAGATGG + Intergenic
1198273294 X:135076076-135076098 AGCACCTGGAAAATGGAAGAAGG - Intergenic
1198302599 X:135346005-135346027 GTCACATGGTAAATGCCAGAGGG - Intronic
1198466318 X:136907795-136907817 GTCTCCTGGTGATTGGCAGGCGG - Intergenic