ID: 1136632387

View in Genome Browser
Species Human (GRCh38)
Location 16:31496574-31496596
Sequence CTGGATGTTCTGATCACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136632387_1136632396 13 Left 1136632387 16:31496574-31496596 CCTCATGTGATCAGAACATCCAG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1136632396 16:31496610-31496632 GTCTGAAGAGGGCAAGGCTGAGG 0: 1
1: 0
2: 2
3: 39
4: 370
1136632387_1136632395 7 Left 1136632387 16:31496574-31496596 CCTCATGTGATCAGAACATCCAG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1136632395 16:31496604-31496626 GGTGGGGTCTGAAGAGGGCAAGG 0: 1
1: 0
2: 4
3: 62
4: 522
1136632387_1136632394 2 Left 1136632387 16:31496574-31496596 CCTCATGTGATCAGAACATCCAG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1136632394 16:31496599-31496621 TGCACGGTGGGGTCTGAAGAGGG 0: 1
1: 0
2: 1
3: 14
4: 142
1136632387_1136632397 14 Left 1136632387 16:31496574-31496596 CCTCATGTGATCAGAACATCCAG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1136632397 16:31496611-31496633 TCTGAAGAGGGCAAGGCTGAGGG 0: 1
1: 0
2: 4
3: 41
4: 392
1136632387_1136632390 -10 Left 1136632387 16:31496574-31496596 CCTCATGTGATCAGAACATCCAG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1136632390 16:31496587-31496609 GAACATCCAGCTTGCACGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1136632387_1136632391 -9 Left 1136632387 16:31496574-31496596 CCTCATGTGATCAGAACATCCAG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1136632391 16:31496588-31496610 AACATCCAGCTTGCACGGTGGGG 0: 1
1: 0
2: 0
3: 2
4: 52
1136632387_1136632393 1 Left 1136632387 16:31496574-31496596 CCTCATGTGATCAGAACATCCAG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1136632393 16:31496598-31496620 TTGCACGGTGGGGTCTGAAGAGG 0: 1
1: 0
2: 1
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136632387 Original CRISPR CTGGATGTTCTGATCACATG AGG (reversed) Intronic
903404784 1:23087250-23087272 CTGTATGTTTTAATCTCATGGGG - Exonic
904011845 1:27394330-27394352 CTGGATGGCCTGACCACATGTGG + Exonic
904477082 1:30772334-30772356 CTGGCTGCTCTGCTCCCATGTGG - Intergenic
905461382 1:38125097-38125119 ATGGATGTACAGATCACCTGGGG - Intergenic
907466604 1:54641931-54641953 CTGGATTTTCTGTTACCATGTGG + Exonic
909472389 1:76043141-76043163 CGAGATGGTCTGATCACTTGAGG + Intergenic
910055399 1:83027685-83027707 TTGGATGTAATGATCAAATGGGG + Intergenic
916839142 1:168582012-168582034 CTGCAAATTGTGATCACATGAGG - Exonic
917919425 1:179738039-179738061 CTGCATGTTCTTGGCACATGTGG + Intergenic
918041406 1:180916269-180916291 CTGGATGTTCTGTTTTCCTGAGG - Exonic
918387139 1:184020937-184020959 TTGGATGTTCTCATGGCATGGGG + Intronic
920583712 1:207137341-207137363 CAGGAGGTCCTGATGACATGTGG + Intronic
922368232 1:224885879-224885901 CTGGCTGGTCTGATGACCTGAGG - Intergenic
1062965701 10:1606242-1606264 CTCGAAGTTCTCCTCACATGGGG + Intronic
1063112658 10:3050104-3050126 AAGGATTTTCTGCTCACATGGGG - Intergenic
1065858069 10:29846773-29846795 CAGGAGGTCCTGATGACATGGGG + Intergenic
1071403584 10:85304659-85304681 CTAGATGTGTTGATCACATAAGG - Intergenic
1072383657 10:94901085-94901107 CTGCATGTTCTCATCATAGGTGG + Intergenic
1072489699 10:95892481-95892503 CAGGAGGTCCTGATGACATGTGG + Intronic
1074967121 10:118501191-118501213 CTGGATGTGCAGAGCAGATGAGG - Intergenic
1075015676 10:118908572-118908594 CAGGAGGTGCTGTTCACATGGGG + Intergenic
1075018259 10:118927143-118927165 CTGAATGTTCAAATCACCTGGGG - Intergenic
1078829791 11:14968523-14968545 CTGAATGTGCTGATCATTTGAGG - Exonic
1079202501 11:18387590-18387612 GTGTATGTTCTGAACACATGTGG + Intergenic
1079361498 11:19774006-19774028 CTGTGTGTTCACATCACATGGGG - Intronic
1085352761 11:75810628-75810650 GTGAATGTTTGGATCACATGGGG - Intergenic
1085638951 11:78179265-78179287 CTGGATGGGCAGATCACTTGAGG - Intronic
1086875268 11:92088223-92088245 CTGGATGTTCTGCTGATTTGTGG - Intergenic
1087126888 11:94637172-94637194 ATGGAGGCTCTAATCACATGTGG + Intergenic
1088599612 11:111462883-111462905 GAGGATGTGCTCATCACATGTGG - Intergenic
1090831288 11:130422429-130422451 CTGGATGTAATGATGACATCGGG - Intronic
1092064424 12:5578167-5578189 CTGGAAGCTCAGATCACAAGTGG + Intronic
1097031436 12:56092980-56093002 CTGGATGTTCAGGTAACCTGAGG - Exonic
1098311027 12:69149074-69149096 CAGGAGGTCCTGATGACATGTGG - Intergenic
1101670456 12:106866844-106866866 CTGGAAGTTCTGGTTACATAGGG + Intronic
1102995607 12:117347707-117347729 GTGGATGCTGTGATCTCATGCGG - Intronic
1103324120 12:120109063-120109085 GTGCATGGTCTGAGCACATGTGG - Intronic
1108608295 13:52062365-52062387 CTGGATGTTATCTTCACAGGTGG - Intronic
1109132929 13:58611221-58611243 CTGGATGTTGAGAGGACATGGGG + Intergenic
1110208849 13:72948906-72948928 CAGGTTCTTCTGATGACATGTGG + Intronic
1110642702 13:77843831-77843853 CAGGATGTTCTGATACCATTTGG + Intergenic
1112447286 13:99475807-99475829 CAGGAGGTCCTGATGACATGTGG - Intergenic
1121211225 14:92209399-92209421 CTGGGTGTTATGATCACAGGCGG - Intergenic
1127072033 15:55296712-55296734 CTGGAGCCTCTGATGACATGTGG + Intronic
1127387045 15:58475116-58475138 CTGGACTTCCTGACCACATGAGG - Intronic
1129882511 15:79016653-79016675 CTGGGTGTTTTGAAGACATGTGG + Intronic
1129949214 15:79571362-79571384 CTGGAAGTCCTGGTCACTTGAGG - Intergenic
1133394328 16:5433948-5433970 CTGCATGTTCGAATCACCTGGGG + Intergenic
1136381641 16:29898841-29898863 CTGGGTCTTCCGAGCACATGGGG - Intronic
1136632387 16:31496574-31496596 CTGGATGTTCTGATCACATGAGG - Intronic
1137384467 16:48028874-48028896 CTGGATCTTATGATCCCATGAGG - Intergenic
1142478209 17:202164-202186 CTGGATTTTCTGAACAGCTGGGG - Intergenic
1143467279 17:7145911-7145933 CAGGAGGTCCTGATGACATGTGG - Intergenic
1143714094 17:8754805-8754827 CTGGGTGTCCTGCACACATGTGG - Intronic
1147468515 17:40633240-40633262 CAGGATGGGCAGATCACATGGGG - Intronic
1149511789 17:57248125-57248147 CTGTATGTTGTAATCACTTGGGG - Intergenic
1150590826 17:66560720-66560742 CTGTATGTTCGAATCACCTGAGG + Intronic
1152073597 17:78146018-78146040 CTGGATGGGCGGATCACCTGAGG - Intergenic
1158561974 18:58522148-58522170 CTGAAAGTCATGATCACATGGGG + Intronic
1163131338 19:15275164-15275186 CTGAATTTTCTGTTCACAAGAGG + Intronic
1167746804 19:51356434-51356456 CTGGATGTCATGATCACACATGG + Exonic
927180008 2:20438788-20438810 CTGGATGTTCTGTTCCCCTCTGG + Intergenic
930592633 2:53347217-53347239 CTGCATGTTCTCATTAAATGTGG - Intergenic
935066905 2:99657010-99657032 CTGGCTGTTCTGGGCACATGGGG + Intronic
935176334 2:100652616-100652638 CTGTGTGTTCTGTTCACAGGTGG - Intergenic
935287383 2:101577619-101577641 CTGCATGTTCTAATCAAATTTGG + Intergenic
936028591 2:109053430-109053452 CTGGATGTTCTGTTTCTATGGGG - Intergenic
936093957 2:109517701-109517723 CTGGAGGTTCTGATCCCACAGGG + Intergenic
936679989 2:114758933-114758955 ATGGATGTTCAGATAACCTGTGG + Intronic
937294712 2:120803016-120803038 CCGCATGTTCTGACTACATGAGG + Intronic
937603688 2:123771466-123771488 CTGGATGTTGTGACTAGATGGGG - Intergenic
939895394 2:147785235-147785257 CTGGATGTGGTGATTAAATGGGG - Intergenic
941220037 2:162766493-162766515 CTTGATCTTCTGATCACTTCTGG - Intronic
942326800 2:174782705-174782727 CTGGGTGTAGGGATCACATGAGG + Intergenic
944933431 2:204544187-204544209 CTGGATCTTCTGATTTTATGAGG + Intergenic
1170305582 20:14934423-14934445 ATTGATGGTCTGATCTCATGGGG - Intronic
1170680942 20:18524553-18524575 CTGGTGGGTCTGATCACATTTGG + Exonic
1171177705 20:23065945-23065967 CTGAATTTTCTGATAAAATGAGG + Intergenic
1172809197 20:37634917-37634939 CTGGCTGTTTCCATCACATGAGG + Intergenic
1172928014 20:38558350-38558372 CTGGATTTTTTGATGACATTGGG + Exonic
1173447990 20:43137582-43137604 CTGGCTGTTCTCCTCACAGGAGG + Intronic
1173826890 20:46053520-46053542 CTGGATCTCCTCATCACATCTGG + Intronic
1173965334 20:47108344-47108366 CAGCATGTGCAGATCACATGTGG - Intronic
1174006826 20:47417552-47417574 CTGGCTGTTCTGATTTCTTGGGG - Intergenic
1175581661 20:60104548-60104570 CTGGGTGTTGTGAGCACTTGTGG + Intergenic
1175601982 20:60281678-60281700 CTGGATGTTCAGAGGAAATGAGG + Intergenic
1179011166 21:37557335-37557357 CGGGATGTTCTGCTCACACATGG + Intergenic
1182623815 22:31631676-31631698 CTGATTGGTCTGATCCCATGTGG - Intronic
1183112708 22:35662635-35662657 CAGGAAGTCCTGATGACATGTGG - Exonic
1185007839 22:48294409-48294431 CTGGCAGTTCTGGGCACATGTGG - Intergenic
950780096 3:15384272-15384294 TTGGAAGCTCTGAGCACATGAGG - Intronic
950931060 3:16789276-16789298 CTGGAGAATATGATCACATGGGG + Intergenic
953924300 3:46974107-46974129 CTGTATGATTTGATTACATGAGG + Intronic
954330036 3:49884932-49884954 CTGGCTTATCTGTTCACATGAGG - Intergenic
954336985 3:49924444-49924466 CAGGATGGGCTGATCACTTGAGG + Intronic
958598449 3:96260875-96260897 CAGGATGCTCTGATCATGTGGGG - Intergenic
959919800 3:111858219-111858241 CTGCATGTTCTCATCATAAGTGG + Intronic
961376017 3:126466393-126466415 CTGGTGGTTCTGATCTGATGGGG - Intronic
963690827 3:148500203-148500225 CTATCTGGTCTGATCACATGAGG + Intergenic
965098479 3:164267254-164267276 AAGGATATTGTGATCACATGGGG + Intergenic
966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG + Intergenic
971187872 4:24398692-24398714 CTGGATTGTAAGATCACATGAGG + Intergenic
971599728 4:28576804-28576826 CTTGATGTTCTAAGAACATGAGG - Intergenic
973650222 4:52991627-52991649 GAGGATGTTCTGCTCAGATGTGG - Intronic
977720672 4:100236618-100236640 CAGGAGGTCCTGATGACATGTGG + Intergenic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
986297570 5:6451829-6451851 CTGGTTGTTCAGAGCACATATGG + Intronic
986714049 5:10509737-10509759 CTGGCTGTTCTGATTTCATTAGG - Intronic
989214309 5:38888269-38888291 CTTGATGTTCTGCACACGTGGGG + Intronic
994775412 5:104032213-104032235 CTGGTTGCTCTGAGGACATGAGG - Intergenic
995861865 5:116649265-116649287 CTGGATGGTCTGCTTACCTGAGG + Intergenic
996463297 5:123771818-123771840 CTGGATGTTCTTGACACTTGTGG + Intergenic
997261807 5:132471005-132471027 CTGTCTGTTCGGATCACATCTGG - Intronic
997769971 5:136544851-136544873 CTGGTTGTTCTGAGGACCTGAGG + Intergenic
1002056077 5:176598538-176598560 CTGGCTTTCCTGAGCACATGGGG + Exonic
1007422896 6:41730198-41730220 CTGGGTATTATGATCACCTGCGG - Intronic
1010829912 6:80515276-80515298 CTGGTTGTTCTGAGGACCTGAGG + Intergenic
1011719102 6:90136774-90136796 CTGGCTGTTATGTTCACATTTGG - Intronic
1015234892 6:130959343-130959365 TTGGATGTTGTCATCACATGGGG + Intronic
1018215880 6:161527466-161527488 CTGGATGCTATGCCCACATGAGG + Intronic
1020406607 7:7842537-7842559 CTGTATTTTCTGATAACCTGTGG + Intronic
1020781983 7:12529538-12529560 CAGGAGGTTCTGAGAACATGTGG + Intergenic
1020941330 7:14542249-14542271 CAGGATGATGTGATCACTTGAGG - Intronic
1021660387 7:22913919-22913941 CTGGTTGTTCTGAGGACCTGAGG - Intergenic
1023609082 7:41956237-41956259 CTGGAATTTCTGAGCACAGGAGG + Intergenic
1024865357 7:53899809-53899831 CATGATGTTCTAAACACATGGGG - Intergenic
1027549412 7:79572512-79572534 TTGGATGTTCTCTTCACATCTGG - Intergenic
1031356957 7:120798665-120798687 CTGTATGTCCTGATAATATGTGG - Intronic
1031560479 7:123232183-123232205 CTGGATAATCTGACCACCTGAGG + Intergenic
1032406759 7:131661660-131661682 CAGGAGGTCCTGATGACATGTGG + Intergenic
1034673746 7:152876707-152876729 CTGGAGGCCCTGGTCACATGTGG + Intergenic
1035361308 7:158315580-158315602 CTGGAGATTCTGCTCACAGGAGG - Intronic
1037846765 8:22290152-22290174 CTCAATGTTTTGTTCACATGGGG + Intronic
1038045309 8:23761167-23761189 CTGGATGTTCTGGTGACATTTGG + Intergenic
1041143966 8:54852193-54852215 CTGGCTGTTCTAATCACAGCTGG - Intergenic
1041446264 8:57954137-57954159 CTACATGTTCTGTTCACTTGTGG + Intergenic
1041741792 8:61164526-61164548 CATGATGTTCTGCACACATGGGG - Intronic
1045698256 8:104835824-104835846 TTAGATGTTCTGCTCACATATGG - Intronic
1046406062 8:113774143-113774165 ATGGATGTTTAGATCACATGGGG + Intergenic
1048773660 8:137921875-137921897 CTGCATGTCCTGTACACATGGGG + Intergenic
1049085241 8:140473568-140473590 CTGGCTGTGCTGATCTCTTGGGG - Intergenic
1049143064 8:140975407-140975429 CTGAATATTTTTATCACATGTGG - Intronic
1049165181 8:141121272-141121294 CTAGATGTTCTGAGCAGTTGAGG + Intronic
1049601806 8:143511315-143511337 ATGGCTGGTCTGATCAGATGGGG + Intronic
1049631873 8:143663093-143663115 CTGGGTGTGCAGATCACTTGAGG - Intergenic
1049972317 9:832100-832122 CTGGATGCTCAGATAACATCAGG + Intergenic
1050971286 9:11878963-11878985 CATGATGTTTTGAACACATGAGG + Intergenic
1055644342 9:78348752-78348774 CTGGGTGGACTGATGACATGGGG - Intergenic
1056200528 9:84271493-84271515 CTGGCCTTTCTGATGACATGAGG - Intergenic
1058671303 9:107362674-107362696 CTGGATGTTGTGATCTCACAGGG + Intergenic
1062280504 9:135749681-135749703 CGGCATGTTCTGAGCACTTGCGG + Intronic
1186230382 X:7447264-7447286 CTGCATGTTAAAATCACATGGGG - Intergenic
1186687920 X:11944986-11945008 CTGCACGTTGTGATCACCTGGGG + Intergenic
1188001062 X:24982372-24982394 ATGGATGTTCTGTTCAGGTGGGG + Intronic
1188416918 X:29946339-29946361 CTGCATGTTGAGATCCCATGGGG - Intronic
1189187473 X:39066539-39066561 CTGGATGATCTGGACTCATGGGG - Intergenic
1192764873 X:74130086-74130108 CTGGCTGGTCTGATGACCTGAGG + Intergenic
1195772280 X:108364102-108364124 CTGGATGAGCAGATCACTTGAGG - Intronic
1198775355 X:140173220-140173242 CTGGATTTTGGGCTCACATGAGG + Intergenic
1200417368 Y:2926365-2926387 CAGGATGTCCTCATGACATGTGG - Intronic
1201933947 Y:19386152-19386174 CTGGAATTTCTGACCACAAGGGG + Intergenic
1202037969 Y:20654599-20654621 CTGGATGTTCAGATTACCTAGGG - Intergenic