ID: 1136632488

View in Genome Browser
Species Human (GRCh38)
Location 16:31497040-31497062
Sequence CAAGGACAGCATTCAGAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136632488_1136632491 8 Left 1136632488 16:31497040-31497062 CCAAACTCTGAATGCTGTCCTTG 0: 1
1: 0
2: 2
3: 14
4: 188
Right 1136632491 16:31497071-31497093 TTCTCACCTTGATGCCCCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136632488 Original CRISPR CAAGGACAGCATTCAGAGTT TGG (reversed) Intronic
901241819 1:7698688-7698710 CGAGAACAGCATTCAGAACTTGG - Intronic
903021101 1:20395759-20395781 CAAGGACATCATGCTGAGTAGGG + Intergenic
904015545 1:27417420-27417442 CAAGGACACCAGTCAGATTCAGG - Intronic
904987696 1:34565495-34565517 CAAGGACATGAATCACAGTTGGG + Intergenic
906344027 1:45004145-45004167 CAAGGCCAGCATTCATTCTTGGG + Intronic
907489482 1:54800029-54800051 TAAGGACAGCATGCAGGGTAGGG - Intronic
907644113 1:56224446-56224468 GGAGGTCAGAATTCAGAGTTGGG - Intergenic
908819158 1:68065729-68065751 AATGGACAGCCATCAGAGTTGGG - Intergenic
909027735 1:70502406-70502428 TAAGGACTGGATTCAGAGTAGGG - Intergenic
910460116 1:87439973-87439995 CAAAGACAGGAGTCAGAGATTGG + Intergenic
915876278 1:159614690-159614712 CAAGGCCAGCAGAGAGAGTTAGG + Intergenic
917209085 1:172613445-172613467 CAAGGACAATATTCAAAGTCAGG - Intergenic
921014421 1:211175398-211175420 CAAAGACAGCACTCAAAGGTGGG - Intergenic
922112475 1:222574748-222574770 CAAATACAGCATTCAGATATAGG + Intronic
922182574 1:223246749-223246771 CAAGGCCACCACTCAGAGGTGGG + Intronic
924188779 1:241525660-241525682 CAAGGACATCATCCAGAGAAAGG + Intergenic
924225078 1:241915275-241915297 CAAGGACAGCATCAAGGGTATGG + Intergenic
924736988 1:246766872-246766894 CAAGGACAGTCCTCAGACTTAGG - Intronic
1064460648 10:15532016-15532038 CACTGTCAGCATTCTGAGTTAGG + Intronic
1065838080 10:29677380-29677402 CACTGACAGCATTCAGGGCTAGG - Intronic
1066054749 10:31670358-31670380 CAAGGATAGCATTAAGAGGATGG + Intergenic
1067479039 10:46583699-46583721 CAAGGACACCAGCCAGAGTCAGG - Intronic
1067615699 10:47758102-47758124 CAAGGACACCAGCCAGAGTCAGG + Intergenic
1067923831 10:50487241-50487263 CAATGAGAGCATGCAGTGTTTGG - Intronic
1068930428 10:62583569-62583591 CAAGGCCACCATGCACAGTTGGG - Intronic
1070090713 10:73282320-73282342 CAATGACAGGATTCAGAGAAAGG + Intronic
1070507859 10:77131262-77131284 CAAAGACAGCATTCACATATAGG + Intronic
1070932104 10:80268316-80268338 CAAGGACTGTGTTCTGAGTTTGG - Intergenic
1073903527 10:108250429-108250451 CAAAGACACCATTCAAAGGTTGG - Intergenic
1074126483 10:110532578-110532600 AAAGGACAGCAGACAGAATTGGG - Intergenic
1077504124 11:2922336-2922358 CAGGGACAGCAGTCAGGGTGGGG + Intronic
1079237553 11:18700895-18700917 CAAGGGCAGCACTCAGAACTTGG - Intronic
1079286360 11:19136534-19136556 CAAGGCCAACATTCAGATTCAGG + Intronic
1079752293 11:24214123-24214145 CAAGGCCAACATTCAGATTCAGG + Intergenic
1079788499 11:24706490-24706512 CAAGGGCAGAATGCAGAATTTGG - Intronic
1079834601 11:25317723-25317745 CTAGGACAACATTTAAAGTTGGG - Intergenic
1082627839 11:55505331-55505353 AAAGGACAGTCTACAGAGTTAGG - Intergenic
1086908678 11:92447267-92447289 CAAGCACATTTTTCAGAGTTAGG + Intronic
1089092307 11:115888199-115888221 GAATGACAGCATTGAGAGGTGGG - Intergenic
1089136180 11:116251200-116251222 CCAGAAGAGCATTGAGAGTTTGG + Intergenic
1090150047 11:124374445-124374467 CAAAGACACCATTCAAAGGTGGG + Intergenic
1090468752 11:126959482-126959504 CAAGTATAGCATGCAGAGTGAGG - Intronic
1090826241 11:130388592-130388614 TACGGACAGCCTTCATAGTTGGG - Intergenic
1091749643 12:3014370-3014392 CAAGGACAGCCTTCAGTGGATGG + Intronic
1092297967 12:7217218-7217240 CATTTAAAGCATTCAGAGTTTGG + Intronic
1092987362 12:13859213-13859235 CAAGGAGAGAATGCAGACTTTGG - Intronic
1095324043 12:40865652-40865674 ATAGGACAGAATTCAGAGTATGG - Intronic
1095571734 12:43690768-43690790 CAGGGACAGAATTAAGAATTTGG + Intergenic
1097908426 12:64944304-64944326 CCAGGACAGCATTCACAGTTTGG - Intergenic
1101651461 12:106681233-106681255 CAAGGACCTCATACAGGGTTTGG - Intronic
1110359083 13:74605262-74605284 GAAGGACAGGCTTCAGATTTTGG - Intergenic
1110542844 13:76725370-76725392 CACTCACAGCATTCTGAGTTTGG + Intergenic
1115843371 14:37497543-37497565 AAAAGACAGCATTAAGAGTCAGG + Intronic
1116965219 14:51007530-51007552 CAAGGCCAGGATTCAAAGTCAGG - Intronic
1117474957 14:56084590-56084612 CAAGTCCAACATTTAGAGTTTGG - Intergenic
1117636616 14:57751388-57751410 GAAGGACATCATTCTGAGTCAGG - Intronic
1117966769 14:61214327-61214349 CAAGGTCAGGGTTAAGAGTTTGG + Intronic
1118544866 14:66874771-66874793 CAAGTACAGCAATCAGAAGTAGG - Intronic
1120572848 14:86143345-86143367 CAAGGACAACAATCAGTGTTTGG - Intergenic
1124364922 15:29064518-29064540 CCAGGACAGGCTCCAGAGTTAGG + Intronic
1125226888 15:37405583-37405605 CAAGGACAGCATCAAGAGGATGG + Intergenic
1125867425 15:43065590-43065612 AAATGACAGCATGCAGTGTTTGG + Intronic
1126477887 15:49085569-49085591 CAAGTACAGCAATGAGAGGTGGG - Intergenic
1126539831 15:49809684-49809706 AGAGCACAGGATTCAGAGTTGGG - Intergenic
1127908141 15:63392476-63392498 CCAGGACAGCATGTAGAGTTTGG - Intergenic
1127956711 15:63860058-63860080 CACCCACAGAATTCAGAGTTGGG + Intergenic
1128537382 15:68501314-68501336 CAAAGCCAGCATTTACAGTTTGG - Intergenic
1131474387 15:92724300-92724322 CAAGGACAGCAAATAGAGTGAGG - Intronic
1132806205 16:1776254-1776276 CCAGGACAGCATGCAGCCTTGGG + Exonic
1134626165 16:15724413-15724435 CAAGGACAGCGTCCAGGGTAGGG + Exonic
1136632488 16:31497040-31497062 CAAGGACAGCATTCAGAGTTTGG - Intronic
1137811565 16:51357659-51357681 CCAGGACAGGCTTCAAAGTTAGG - Intergenic
1138152356 16:54670395-54670417 CAAAGACACCATTCAAAGGTGGG + Intergenic
1138388928 16:56656085-56656107 CAATGACAGCATACACAGCTAGG - Intronic
1140974794 16:80049262-80049284 CAAAGACAACATACAGACTTGGG - Intergenic
1141397188 16:83715720-83715742 CCAGGCCAGGAGTCAGAGTTGGG + Intronic
1146779501 17:35656062-35656084 CAATGACACCATTAAGAGATTGG - Intronic
1147678505 17:42223934-42223956 CAAGGACGGCATTAAGCATTAGG + Intronic
1151329426 17:73398228-73398250 CCAGGACAGGGTTGAGAGTTGGG - Intronic
1151388247 17:73768525-73768547 CAATGACAGTATTGAGAGTGGGG - Intergenic
1152398340 17:80048848-80048870 CAAGTACAGCATTTAGGGTCAGG - Intronic
1152948636 17:83212410-83212432 CAAGAACAACATCAAGAGTTGGG + Intergenic
1155240056 18:23856468-23856490 CAAGCACTGCATTCAGAGCTGGG - Intronic
1156634761 18:39013780-39013802 CAAGGATAGGACACAGAGTTTGG + Intergenic
1156670139 18:39458888-39458910 GAAGAACAGCACTGAGAGTTTGG - Intergenic
1156856275 18:41784890-41784912 AAAGGACTGTATTCAGTGTTTGG + Intergenic
1157139102 18:45088003-45088025 GAAGAACAGCCTTGAGAGTTTGG - Intergenic
1159362236 18:67420205-67420227 CAAGGACAGCATCAAGAGAATGG + Intergenic
1159686520 18:71428002-71428024 GAATGACAACATTCAGTGTTAGG + Intergenic
1162323929 19:9987197-9987219 CAAGTGCAGTTTTCAGAGTTTGG - Intronic
1167535346 19:50047232-50047254 CAACGTCAGGATTCAGAGGTAGG + Exonic
925233890 2:2260445-2260467 CAAGCACAGCATTCAGTTTCTGG - Intronic
926522978 2:13940419-13940441 AAATGAGAGCATTCAAAGTTGGG + Intergenic
928371124 2:30740963-30740985 CAAGGACAGTGATCAGTGTTGGG + Intronic
928818478 2:35329141-35329163 GAAGGACAGCAGTCCGAGGTTGG - Intergenic
930175170 2:48294220-48294242 AAAGGAAAGCATTCATAGTTAGG - Intergenic
933878394 2:86643645-86643667 CAAGGACAGCATCAAGAGGATGG - Intronic
938250727 2:129813602-129813624 AAAGGACAGCATTCAGCATAGGG + Intergenic
941313116 2:163959092-163959114 CAAGGACAGAACCCAAAGTTGGG + Intergenic
942123233 2:172799499-172799521 CCAGGACAGCATCCACAGGTAGG - Intronic
942147863 2:173043887-173043909 CAAAGACAGCATCCAGAGGAAGG - Intronic
943375284 2:187068751-187068773 CAAAGACAGCACTCAAAGGTGGG + Intergenic
944325502 2:198399273-198399295 CAACTACAGCATTCACAGCTAGG - Intronic
945435952 2:209817716-209817738 CAAGGACAGCAGGGAGAGTGTGG - Intronic
947343146 2:229161031-229161053 CAATGACATTATTCAGTGTTGGG - Intronic
947373907 2:229475878-229475900 CAAGGCCTTCAATCAGAGTTAGG + Intronic
948734018 2:239987228-239987250 CCAGGACAGCTGTCAGAGTCAGG - Intronic
948975291 2:241460025-241460047 ATAGAACAACATTCAGAGTTAGG + Intronic
1170898402 20:20436991-20437013 CACCGGCAGCATTCAGAGCTCGG - Intronic
1171251844 20:23654804-23654826 CAAGCACATCCTTCACAGTTAGG + Intergenic
1171480845 20:25454661-25454683 CACGGACCACATTCAGTGTTAGG - Intronic
1172408732 20:34707225-34707247 CAAGGGCAGCATCCAGGGGTAGG - Intronic
1175839226 20:62016097-62016119 CAAGGACAGCCTTCAAAGCCAGG + Intronic
1177434973 21:21039795-21039817 CAAGTACAGCACTAAGTGTTAGG + Intronic
1178672069 21:34600284-34600306 CCAGGGCAGCATTCAGAGATAGG + Intronic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1180595090 22:16967828-16967850 CAAGGGCAGTACTCAGAGTCAGG - Intronic
1181288502 22:21772454-21772476 CAGGGACAGCACACAGAGTGGGG - Intronic
949217321 3:1584828-1584850 CAAACACAGAATTCAGAATTTGG + Intergenic
949924169 3:9027943-9027965 CAAGGAAAGAATTCACAGGTGGG - Intronic
950820329 3:15750509-15750531 CAAGGACCCAGTTCAGAGTTAGG + Intronic
954750830 3:52812695-52812717 CAAGCACAGGATTCAGAGTTGGG + Intergenic
955951984 3:64251641-64251663 CATGGACAGACATCAGAGTTTGG + Intronic
958850827 3:99323281-99323303 CAAGGACAGAAGTCAGAAATTGG - Intergenic
960922530 3:122761832-122761854 AATAGACAGCATTGAGAGTTGGG + Intronic
967394267 3:188989791-188989813 GAAGGGCAGCATTCACAGCTCGG - Intronic
968504255 4:964630-964652 GAAGGGCAGCGTTCAAAGTTTGG + Intronic
968615081 4:1574110-1574132 CAAAGACAGCACATAGAGTTTGG + Intergenic
968675662 4:1877600-1877622 CAGGCACAGCATTCAGTGTGGGG - Intronic
969882624 4:10187711-10187733 CTAGGGCAACATTGAGAGTTTGG - Intergenic
972930506 4:44066174-44066196 AAAGGACAGATGTCAGAGTTAGG - Intergenic
974276446 4:59726443-59726465 TAAGGGCAGCATTCAGGTTTAGG - Intergenic
976668853 4:87629406-87629428 CAAGGAGGGCATTCTGAGTGAGG + Intergenic
977389740 4:96392181-96392203 CAATGAGATCTTTCAGAGTTTGG - Intergenic
977627626 4:99204500-99204522 CAAAGATAGGATTCAGAATTAGG + Intronic
978452313 4:108847999-108848021 CGTGGACAGTATTCAGAATTTGG - Intronic
978690354 4:111501690-111501712 CAATGACAGCATTAAAAGATAGG + Intergenic
980048427 4:128014304-128014326 CAAGCCCAGAATTCAGAATTAGG + Intronic
980176500 4:129352116-129352138 CAAGGACAGCAATAAGAAATAGG + Intergenic
980612897 4:135182256-135182278 CAAGGCCAACATTCAGATTCAGG - Intergenic
980762076 4:137247849-137247871 CAAGGATTGCACTCTGAGTTAGG - Intergenic
980988562 4:139718631-139718653 CAAGGAGAGCAGGCTGAGTTTGG - Exonic
985822907 5:2172491-2172513 CAAAGCCAGGATTCAGAGCTGGG + Intergenic
988958505 5:36345131-36345153 CAAGGACATCCCTGAGAGTTGGG + Intergenic
990033316 5:51288898-51288920 CAAGAACATCTTTCAGAGCTAGG + Intergenic
990450440 5:55928000-55928022 CAAATACAGCATTCAGAATTGGG - Intergenic
999426213 5:151489638-151489660 CAAGGTCAGCCTTCAGATTTGGG + Exonic
1000392933 5:160744316-160744338 AAATGACAGCATTCAGAAGTAGG - Intronic
1001467274 5:171978635-171978657 CATGGACAGTATGCAGAGTGAGG + Intronic
1002199719 5:177520932-177520954 CCAGGACAGCCTTCAGAGCTGGG - Intronic
1003524928 6:6889667-6889689 TAAGGACAGCCTTCACACTTTGG - Intergenic
1003956373 6:11169097-11169119 CAAAGACAGAAGTCAGGGTTAGG - Intergenic
1004352655 6:14903768-14903790 CTATGCCAGCATTTAGAGTTAGG - Intergenic
1006007349 6:31013043-31013065 GATGGACATCATTCAGTGTTTGG - Intronic
1007079672 6:39090497-39090519 AAAGAACAGCATTCACAGTATGG - Intergenic
1007315411 6:40984298-40984320 CAAGGACAGAAGCCAAAGTTGGG + Intergenic
1009523284 6:64711908-64711930 CAAAGACACCACTCAAAGTTGGG + Intronic
1012199514 6:96388122-96388144 CATGAACAGCATTCATTGTTAGG - Intergenic
1014401962 6:121000672-121000694 CAAAGACAGAAAGCAGAGTTTGG + Intergenic
1016865529 6:148762049-148762071 CAAGAACAGCCTTTTGAGTTGGG - Intronic
1021432142 7:20572232-20572254 GAATGACAACATTCAGTGTTTGG - Intergenic
1021715596 7:23459260-23459282 CAAAGACAGGATTCATAATTGGG + Intronic
1022697529 7:32724348-32724370 GAAGGCCAGCCTTCAGACTTTGG - Intergenic
1023094906 7:36650487-36650509 CAATGACAGCTTTCAGGCTTAGG + Intronic
1024351846 7:48374514-48374536 CAAGTAGAGCATTCAGAATGAGG + Intronic
1025682102 7:63688828-63688850 CTGGGACAGAAGTCAGAGTTAGG + Intergenic
1026462456 7:70626748-70626770 AAATGACAGCATTCAGTATTTGG + Intronic
1028496074 7:91462953-91462975 CAAAGACAGCACTCAAAGATGGG - Intergenic
1029665695 7:101993724-101993746 CTGGGACAGAAGTCAGAGTTAGG - Intronic
1033258270 7:139820445-139820467 CAATGCCACCATTCAGACTTTGG - Intronic
1033788620 7:144764042-144764064 ATAGGGCAGCATTGAGAGTTTGG - Intronic
1035887718 8:3309678-3309700 AAAAGAAAGCATTCAAAGTTTGG - Intronic
1036092745 8:5686122-5686144 CAATGTCAGCCATCAGAGTTAGG - Intergenic
1038133103 8:24756059-24756081 AAAGAACAGCCTTCAGAATTAGG + Intergenic
1038547346 8:28435663-28435685 CAAAGACACCATTCAAAGGTGGG + Intronic
1038834230 8:31100998-31101020 TAAGGAGAGCATTCAGGATTGGG + Intronic
1039844313 8:41315275-41315297 CAAGGACAGCAAACATAGTGTGG + Intergenic
1041370733 8:57157962-57157984 TTAGGACAGCATAAAGAGTTAGG + Intergenic
1041687232 8:60654790-60654812 CAAGGATCTCCTTCAGAGTTAGG - Intergenic
1042340809 8:67677053-67677075 CAGGGACATCATTCACATTTAGG + Intronic
1043132845 8:76483093-76483115 CCAGGAGAGCAGTCTGAGTTTGG - Intergenic
1043531033 8:81150175-81150197 CAAGAACAGCTTTCTGAGTTTGG + Intergenic
1044915323 8:97107387-97107409 CAAGCACACCCTTCAGAGTATGG - Intronic
1045012341 8:97969091-97969113 CAAGGACAAGAGTGAGAGTTGGG + Intronic
1045064396 8:98433013-98433035 CAAGGAGGGCATTCAAAGTTGGG + Intronic
1046414724 8:113898005-113898027 CAACAACAGGATTCATAGTTTGG + Intergenic
1047412160 8:124632636-124632658 TAAGAACAGCATTCAGAATTAGG + Intronic
1047412247 8:124633300-124633322 TAAGAACAGCATTCAGAATTAGG + Intronic
1047662247 8:127049960-127049982 AAAGGACAGCAGTCAGAGGTTGG - Intergenic
1047986003 8:130234468-130234490 CAAGGGCTGTATGCAGAGTTTGG - Intronic
1048710140 8:137200842-137200864 ATTGGACACCATTCAGAGTTGGG - Intergenic
1051550740 9:18326105-18326127 CTATGACAGCATTAAGAGGTGGG - Intergenic
1053414577 9:37938990-37939012 CAAGGACCACATCCAGATTTCGG - Intronic
1055701911 9:78953984-78954006 CAAGGACAGGTTTTTGAGTTAGG + Intergenic
1058460462 9:105177785-105177807 CAGGGACAGGAATCAGACTTTGG - Intergenic
1059045035 9:110857422-110857444 CAAGGAAAGCATGCAGAGTGAGG - Intergenic
1059261594 9:112982303-112982325 GAATGACACCATTCAGGGTTAGG - Intergenic
1059496725 9:114716157-114716179 CAAGGACACCAGTCAGATTAGGG + Intergenic
1061031654 9:128088183-128088205 CAAGGACAGCATTTAGCCTAGGG + Intronic
1185854818 X:3524283-3524305 CAAAGACAGCAATGAGAGCTAGG + Intergenic
1188126800 X:26377976-26377998 GAATGAGAGCATTCAGTGTTTGG + Intergenic
1192126797 X:68508565-68508587 CAAAGAAAGAATTCAGAGCTAGG - Intronic
1197396315 X:125931938-125931960 CAAAGACACCATTCAAAGGTGGG + Intergenic
1198978992 X:142372956-142372978 CAAGGACTACATTCAATGTTCGG + Intergenic
1201361929 Y:13161410-13161432 CAAGTACAGCCTTCCCAGTTGGG - Intergenic