ID: 1136636919

View in Genome Browser
Species Human (GRCh38)
Location 16:31529863-31529885
Sequence TTCCCTTTCCACCCTGATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136636919_1136636929 20 Left 1136636919 16:31529863-31529885 CCTGGATCAGGGTGGAAAGGGAA No data
Right 1136636929 16:31529906-31529928 GTGCTTCCAACCCTGGGGTGTGG No data
1136636919_1136636920 -2 Left 1136636919 16:31529863-31529885 CCTGGATCAGGGTGGAAAGGGAA No data
Right 1136636920 16:31529884-31529906 AACCCGCTCAGTGTCCCCAGCGG No data
1136636919_1136636927 14 Left 1136636919 16:31529863-31529885 CCTGGATCAGGGTGGAAAGGGAA No data
Right 1136636927 16:31529900-31529922 CCAGCGGTGCTTCCAACCCTGGG No data
1136636919_1136636930 24 Left 1136636919 16:31529863-31529885 CCTGGATCAGGGTGGAAAGGGAA No data
Right 1136636930 16:31529910-31529932 TTCCAACCCTGGGGTGTGGTCGG No data
1136636919_1136636925 13 Left 1136636919 16:31529863-31529885 CCTGGATCAGGGTGGAAAGGGAA No data
Right 1136636925 16:31529899-31529921 CCCAGCGGTGCTTCCAACCCTGG No data
1136636919_1136636928 15 Left 1136636919 16:31529863-31529885 CCTGGATCAGGGTGGAAAGGGAA No data
Right 1136636928 16:31529901-31529923 CAGCGGTGCTTCCAACCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136636919 Original CRISPR TTCCCTTTCCACCCTGATCC AGG (reversed) Intergenic
No off target data available for this crispr