ID: 1136638804

View in Genome Browser
Species Human (GRCh38)
Location 16:31544196-31544218
Sequence CTGGATGTATAGATAGACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136638804_1136638808 15 Left 1136638804 16:31544196-31544218 CCATAGTCTATCTATACATCCAG No data
Right 1136638808 16:31544234-31544256 CTAGGTAGAGAGAAACTTTTAGG No data
1136638804_1136638807 -3 Left 1136638804 16:31544196-31544218 CCATAGTCTATCTATACATCCAG No data
Right 1136638807 16:31544216-31544238 CAGGTAAGTTACAGTTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136638804 Original CRISPR CTGGATGTATAGATAGACTA TGG (reversed) Intergenic
No off target data available for this crispr