ID: 1136640985

View in Genome Browser
Species Human (GRCh38)
Location 16:31564888-31564910
Sequence TGGACATGGCTCACTCCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136640979_1136640985 30 Left 1136640979 16:31564835-31564857 CCAGAATCAGGTGCAGGTTGTTC No data
Right 1136640985 16:31564888-31564910 TGGACATGGCTCACTCCTACTGG No data
1136640980_1136640985 0 Left 1136640980 16:31564865-31564887 CCTGTTTTTCTAAGCCCTTAAGC No data
Right 1136640985 16:31564888-31564910 TGGACATGGCTCACTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136640985 Original CRISPR TGGACATGGCTCACTCCTAC TGG Intergenic
No off target data available for this crispr