ID: 1136640991

View in Genome Browser
Species Human (GRCh38)
Location 16:31564933-31564955
Sequence CTTATTGAGGCCATGATGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136640991_1136640995 5 Left 1136640991 16:31564933-31564955 CCACTCATCATGGCCTCAATAAG No data
Right 1136640995 16:31564961-31564983 TTTCCATCATGAACACCTTGGGG No data
1136640991_1136640993 3 Left 1136640991 16:31564933-31564955 CCACTCATCATGGCCTCAATAAG No data
Right 1136640993 16:31564959-31564981 TTTTTCCATCATGAACACCTTGG No data
1136640991_1136640994 4 Left 1136640991 16:31564933-31564955 CCACTCATCATGGCCTCAATAAG No data
Right 1136640994 16:31564960-31564982 TTTTCCATCATGAACACCTTGGG No data
1136640991_1136640998 23 Left 1136640991 16:31564933-31564955 CCACTCATCATGGCCTCAATAAG No data
Right 1136640998 16:31564979-31565001 TGGGGACCTAGACACAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136640991 Original CRISPR CTTATTGAGGCCATGATGAG TGG (reversed) Intergenic
No off target data available for this crispr