ID: 1136640993

View in Genome Browser
Species Human (GRCh38)
Location 16:31564959-31564981
Sequence TTTTTCCATCATGAACACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136640989_1136640993 10 Left 1136640989 16:31564926-31564948 CCTCCTGCCACTCATCATGGCCT No data
Right 1136640993 16:31564959-31564981 TTTTTCCATCATGAACACCTTGG No data
1136640991_1136640993 3 Left 1136640991 16:31564933-31564955 CCACTCATCATGGCCTCAATAAG No data
Right 1136640993 16:31564959-31564981 TTTTTCCATCATGAACACCTTGG No data
1136640990_1136640993 7 Left 1136640990 16:31564929-31564951 CCTGCCACTCATCATGGCCTCAA No data
Right 1136640993 16:31564959-31564981 TTTTTCCATCATGAACACCTTGG No data
1136640988_1136640993 11 Left 1136640988 16:31564925-31564947 CCCTCCTGCCACTCATCATGGCC No data
Right 1136640993 16:31564959-31564981 TTTTTCCATCATGAACACCTTGG No data
1136640992_1136640993 -10 Left 1136640992 16:31564946-31564968 CCTCAATAAGAAATTTTTCCATC No data
Right 1136640993 16:31564959-31564981 TTTTTCCATCATGAACACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136640993 Original CRISPR TTTTTCCATCATGAACACCT TGG Intergenic
No off target data available for this crispr