ID: 1136641531

View in Genome Browser
Species Human (GRCh38)
Location 16:31569362-31569384
Sequence TGCACCCCAAGCCGCGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 173}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641531_1136641533 -8 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641533 16:31569377-31569399 GGGGTGCACCGCTGCCCACCCGG 0: 1
1: 1
2: 0
3: 11
4: 171
1136641531_1136641545 15 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641545 16:31569400-31569422 CTCTTGGTCGCGGGGTCCTGGGG 0: 1
1: 1
2: 0
3: 3
4: 94
1136641531_1136641534 -1 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641534 16:31569384-31569406 ACCGCTGCCCACCCGGCTCTTGG 0: 1
1: 1
2: 1
3: 7
4: 124
1136641531_1136641546 23 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641546 16:31569408-31569430 CGCGGGGTCCTGGGGAGCCGCGG No data
1136641531_1136641540 7 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641540 16:31569392-31569414 CCACCCGGCTCTTGGTCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 41
1136641531_1136641538 6 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641538 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 3
3: 12
4: 63
1136641531_1136641536 5 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641536 16:31569390-31569412 GCCCACCCGGCTCTTGGTCGCGG 0: 1
1: 0
2: 2
3: 5
4: 67
1136641531_1136641544 14 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641544 16:31569399-31569421 GCTCTTGGTCGCGGGGTCCTGGG 0: 1
1: 1
2: 0
3: 5
4: 65
1136641531_1136641543 13 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641543 16:31569398-31569420 GGCTCTTGGTCGCGGGGTCCTGG 0: 1
1: 1
2: 1
3: 5
4: 82
1136641531_1136641547 26 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641547 16:31569411-31569433 GGGGTCCTGGGGAGCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641531 Original CRISPR TGCACCCCAAGCCGCGGCCC CGG (reversed) Intergenic