ID: 1136641532

View in Genome Browser
Species Human (GRCh38)
Location 16:31569368-31569390
Sequence CAGCGGTGCACCCCAAGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 82}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641532_1136641538 0 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641538 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 3
3: 12
4: 63
1136641532_1136641546 17 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641546 16:31569408-31569430 CGCGGGGTCCTGGGGAGCCGCGG No data
1136641532_1136641543 7 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641543 16:31569398-31569420 GGCTCTTGGTCGCGGGGTCCTGG 0: 1
1: 1
2: 1
3: 5
4: 82
1136641532_1136641536 -1 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641536 16:31569390-31569412 GCCCACCCGGCTCTTGGTCGCGG 0: 1
1: 0
2: 2
3: 5
4: 67
1136641532_1136641545 9 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641545 16:31569400-31569422 CTCTTGGTCGCGGGGTCCTGGGG 0: 1
1: 1
2: 0
3: 3
4: 94
1136641532_1136641540 1 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641540 16:31569392-31569414 CCACCCGGCTCTTGGTCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 41
1136641532_1136641544 8 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641544 16:31569399-31569421 GCTCTTGGTCGCGGGGTCCTGGG 0: 1
1: 1
2: 0
3: 5
4: 65
1136641532_1136641547 20 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641547 16:31569411-31569433 GGGGTCCTGGGGAGCCGCGGCGG No data
1136641532_1136641534 -7 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641534 16:31569384-31569406 ACCGCTGCCCACCCGGCTCTTGG 0: 1
1: 1
2: 1
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641532 Original CRISPR CAGCGGTGCACCCCAAGCCG CGG (reversed) Intergenic