ID: 1136641535

View in Genome Browser
Species Human (GRCh38)
Location 16:31569385-31569407
Sequence ACCAAGAGCCGGGTGGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 238}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641535_1136641549 16 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641549 16:31569424-31569446 GCCGCGGCGGCCGCCACCGCAGG 0: 1
1: 0
2: 20
3: 152
4: 526
1136641535_1136641546 0 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641546 16:31569408-31569430 CGCGGGGTCCTGGGGAGCCGCGG No data
1136641535_1136641552 26 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1136641535_1136641547 3 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641547 16:31569411-31569433 GGGGTCCTGGGGAGCCGCGGCGG No data
1136641535_1136641555 30 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1136641535_1136641554 29 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641554 16:31569437-31569459 CCACCGCAGGAGCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 23
4: 217
1136641535_1136641543 -10 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641543 16:31569398-31569420 GGCTCTTGGTCGCGGGGTCCTGG 0: 1
1: 1
2: 1
3: 5
4: 82
1136641535_1136641544 -9 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641544 16:31569399-31569421 GCTCTTGGTCGCGGGGTCCTGGG 0: 1
1: 1
2: 0
3: 5
4: 65
1136641535_1136641545 -8 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641545 16:31569400-31569422 CTCTTGGTCGCGGGGTCCTGGGG 0: 1
1: 1
2: 0
3: 3
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641535 Original CRISPR ACCAAGAGCCGGGTGGGCAG CGG (reversed) Intergenic