ID: 1136641537

View in Genome Browser
Species Human (GRCh38)
Location 16:31569391-31569413
Sequence CCCGCGACCAAGAGCCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 29}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641537_1136641549 10 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641549 16:31569424-31569446 GCCGCGGCGGCCGCCACCGCAGG 0: 1
1: 0
2: 20
3: 152
4: 526
1136641537_1136641555 24 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1136641537_1136641558 30 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641558 16:31569444-31569466 AGGAGCCTGCTGGAGGGTGGTGG 0: 1
1: 3
2: 39
3: 335
4: 2406
1136641537_1136641546 -6 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641546 16:31569408-31569430 CGCGGGGTCCTGGGGAGCCGCGG No data
1136641537_1136641554 23 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641554 16:31569437-31569459 CCACCGCAGGAGCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 23
4: 217
1136641537_1136641552 20 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1136641537_1136641557 27 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641557 16:31569441-31569463 CGCAGGAGCCTGCTGGAGGGTGG 0: 1
1: 0
2: 4
3: 117
4: 807
1136641537_1136641547 -3 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641547 16:31569411-31569433 GGGGTCCTGGGGAGCCGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641537 Original CRISPR CCCGCGACCAAGAGCCGGGT GGG (reversed) Intergenic