ID: 1136641542

View in Genome Browser
Species Human (GRCh38)
Location 16:31569396-31569418
Sequence AGGACCCCGCGACCAAGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641542_1136641558 25 Left 1136641542 16:31569396-31569418 CCGGCTCTTGGTCGCGGGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1136641558 16:31569444-31569466 AGGAGCCTGCTGGAGGGTGGTGG 0: 1
1: 3
2: 39
3: 335
4: 2406
1136641542_1136641554 18 Left 1136641542 16:31569396-31569418 CCGGCTCTTGGTCGCGGGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1136641554 16:31569437-31569459 CCACCGCAGGAGCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 23
4: 217
1136641542_1136641552 15 Left 1136641542 16:31569396-31569418 CCGGCTCTTGGTCGCGGGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1136641542_1136641547 -8 Left 1136641542 16:31569396-31569418 CCGGCTCTTGGTCGCGGGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1136641547 16:31569411-31569433 GGGGTCCTGGGGAGCCGCGGCGG No data
1136641542_1136641549 5 Left 1136641542 16:31569396-31569418 CCGGCTCTTGGTCGCGGGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1136641549 16:31569424-31569446 GCCGCGGCGGCCGCCACCGCAGG 0: 1
1: 0
2: 20
3: 152
4: 526
1136641542_1136641557 22 Left 1136641542 16:31569396-31569418 CCGGCTCTTGGTCGCGGGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1136641557 16:31569441-31569463 CGCAGGAGCCTGCTGGAGGGTGG 0: 1
1: 0
2: 4
3: 117
4: 807
1136641542_1136641555 19 Left 1136641542 16:31569396-31569418 CCGGCTCTTGGTCGCGGGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641542 Original CRISPR AGGACCCCGCGACCAAGAGC CGG (reversed) Intergenic