ID: 1136641544

View in Genome Browser
Species Human (GRCh38)
Location 16:31569399-31569421
Sequence GCTCTTGGTCGCGGGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 65}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641532_1136641544 8 Left 1136641532 16:31569368-31569390 CCGCGGCTTGGGGTGCACCGCTG 0: 1
1: 0
2: 2
3: 3
4: 82
Right 1136641544 16:31569399-31569421 GCTCTTGGTCGCGGGGTCCTGGG 0: 1
1: 1
2: 0
3: 5
4: 65
1136641531_1136641544 14 Left 1136641531 16:31569362-31569384 CCGGGGCCGCGGCTTGGGGTGCA 0: 1
1: 0
2: 1
3: 23
4: 173
Right 1136641544 16:31569399-31569421 GCTCTTGGTCGCGGGGTCCTGGG 0: 1
1: 1
2: 0
3: 5
4: 65
1136641535_1136641544 -9 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641544 16:31569399-31569421 GCTCTTGGTCGCGGGGTCCTGGG 0: 1
1: 1
2: 0
3: 5
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641544 Original CRISPR GCTCTTGGTCGCGGGGTCCT GGG Intergenic
900308583 1:2022766-2022788 TCCCGTGGGCGCGGGGTCCTGGG + Intronic
900517754 1:3091163-3091185 GCTATTGGTCGGTGGCTCCTTGG - Intronic
906472123 1:46139924-46139946 GTTCTTGTTTGCAGGGTCCTGGG - Intronic
915363506 1:155300611-155300633 GCTGCAGGTCGGGGGGTCCTGGG - Intronic
917968920 1:180195066-180195088 GCACTTGGTCGTGGTCTCCTGGG + Intronic
919751341 1:201040060-201040082 GCTCTGGTTCGAGGGGGCCTGGG - Exonic
1075256611 10:120930567-120930589 GTTCCTGGTCCCAGGGTCCTGGG - Intergenic
1075658484 10:124176986-124177008 GCTCTTGGTGCAGGGCTCCTTGG + Intergenic
1076922999 10:133465306-133465328 GCTCTGGCACGCGGGCTCCTGGG + Intergenic
1083302447 11:61746067-61746089 TCTCTTGGTCGGGGGAGCCTAGG - Exonic
1084393947 11:68896749-68896771 GCTCCTGGTGGTGGGGCCCTAGG + Intronic
1090351404 11:126110765-126110787 ACTCTGGGTCCCGGGGTCCTTGG + Intergenic
1090768964 11:129902394-129902416 GCTGTTGGTCTGGGGGTCCAGGG + Exonic
1092241223 12:6837621-6837643 GCTCTTGGGGGCAGTGTCCTGGG - Intronic
1092659495 12:10723010-10723032 GCTCTTGGGCGCGGGGTCCTGGG + Exonic
1103510123 12:121467874-121467896 GCTCTGGGTCGGGGGTTCCCGGG - Intronic
1103921076 12:124399447-124399469 CCTCTTGGTGGCGGTGTACTTGG - Intronic
1117253469 14:53956267-53956289 GCCCTTGGTAGGGGGGTCGTTGG - Intronic
1119025745 14:71150971-71150993 GCTCATGGTGGCAGGGCCCTGGG - Intergenic
1119262460 14:73245772-73245794 GCTCCTGGCCGCGGGCTGCTGGG + Intronic
1122861616 14:104585080-104585102 GCCCTTGGGGGCAGGGTCCTTGG + Intronic
1128723959 15:69974258-69974280 GCCCTGGGTCGGGGGGTCATGGG - Intergenic
1128797783 15:70477977-70477999 GCTCTTGGGAGTGGGGTGCTGGG - Intergenic
1131827498 15:96332576-96332598 GTCCTGGGTCCCGGGGTCCTGGG + Intronic
1133284273 16:4683375-4683397 CCTCTTGGCCGAGGGTTCCTGGG - Intronic
1135415490 16:22265484-22265506 GCTCCTGGACGAGGGGCCCTGGG - Intronic
1136641544 16:31569399-31569421 GCTCTTGGTCGCGGGGTCCTGGG + Intergenic
1139964332 16:70737202-70737224 GCTCTTGTAAGCAGGGTCCTGGG + Intronic
1142030873 16:87837919-87837941 GCTCTTCTTCGTGGGGTCCCGGG - Exonic
1142140003 16:88468673-88468695 GCTCTGGGGGGCGGGGCCCTGGG - Intronic
1142213960 16:88821889-88821911 GCTCCTGGCCTGGGGGTCCTGGG - Intronic
1148796886 17:50201340-50201362 GCGCTTGGTCCCGGGGGCCGCGG - Intronic
1148818155 17:50345718-50345740 GCTCTCGGTCCCGGGGGCCCAGG - Intergenic
1160537667 18:79603706-79603728 GTTCTTGCTGGCGGGGTCTTGGG + Intergenic
1160537682 18:79603760-79603782 GCTCTTGCTGGCGGGGTCTTGGG + Intergenic
1162799743 19:13103843-13103865 GGTGTTGATCGTGGGGTCCTGGG - Intergenic
1163710909 19:18846227-18846249 ACTCTGGGTGGCGGTGTCCTCGG + Intronic
1164610619 19:29629103-29629125 GCTCCTGGTGTCTGGGTCCTTGG - Intergenic
1166827922 19:45621038-45621060 ACTCTTGGTTGCTGGATCCTGGG + Intronic
1167605911 19:50481179-50481201 GCTCTAGGGCGCAGGGTCCTGGG + Intronic
934751575 2:96797375-96797397 GCTCTGGCTGGCAGGGTCCTGGG - Intronic
948061111 2:235043893-235043915 GCTCTTCTTTGCAGGGTCCTTGG - Intronic
1168984058 20:2032482-2032504 GCTCTTGGAGGCGGGGTCTTTGG + Intergenic
1173158329 20:40633659-40633681 GCTCTTGGGCACAGGGGCCTTGG - Intergenic
1174103767 20:48147565-48147587 GCTCTGGTCTGCGGGGTCCTTGG - Intergenic
1179309968 21:40186573-40186595 GCTCTGGGCCGAGTGGTCCTGGG + Intronic
1179464633 21:41563338-41563360 GCTCATGGTCCTGGAGTCCTGGG + Intergenic
1180013963 21:45071037-45071059 GGTCTTGGTCCTGGTGTCCTAGG - Intergenic
1180980968 22:19877796-19877818 GCTCATGGTGGCGTGGTGCTTGG + Intronic
1181492855 22:23271560-23271582 GTTCTTGGTCGTTGGATCCTTGG - Exonic
1182366124 22:29780595-29780617 GCTCTTTGGCTGGGGGTCCTTGG + Intergenic
1185217368 22:49609145-49609167 GCACTTGGCCGCGTGTTCCTGGG - Intronic
1185315488 22:50177218-50177240 GATCTTGGGCGCGCGGCCCTCGG - Exonic
956097878 3:65736607-65736629 GCTCTTGGTTTCTGGGTCTTCGG - Intronic
960914277 3:122680907-122680929 GCTGCTGGTCGAGGGCTCCTGGG + Exonic
962184510 3:133243874-133243896 ACTCTTGGTCTCAGGGTTCTAGG - Intronic
967924317 3:194633920-194633942 GCTCTTGGCTGCGGGGCCGTGGG - Intergenic
972245777 4:37244535-37244557 GGGCTTGGGCGCGGGGGCCTCGG - Exonic
985512605 5:321061-321083 GCTCTCGGCCGCGCGGTCCCGGG + Intronic
1018612112 6:165656455-165656477 GATCTTGGTGGCAGAGTCCTCGG - Intronic
1019217423 6:170452665-170452687 GCTCTTGGCCCCGGGGGACTGGG - Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1039455018 8:37700367-37700389 GCCCTTGGTGCTGGGGTCCTGGG - Intergenic
1040015542 8:42696236-42696258 GCTCAGGGTCCCGGGGTCCTGGG + Intergenic
1046582542 8:116110985-116111007 CCTCTTGGTACCTGGGTCCTTGG - Intergenic
1055788872 9:79900121-79900143 GCTCTTTGTTGAGGTGTCCTCGG + Intergenic
1056937115 9:90924430-90924452 GTGCTTGGTCCCAGGGTCCTAGG - Intergenic
1058111696 9:101037428-101037450 GCTCTCTGTCGAGGGGTTCTGGG + Intronic
1062167764 9:135116530-135116552 GCCCTTGATCGCGGGGACCCAGG - Intronic
1062523254 9:136968325-136968347 GCACATGGCCGGGGGGTCCTTGG + Intergenic
1186300673 X:8196938-8196960 GCTCTCTGCCACGGGGTCCTAGG - Intergenic
1189262801 X:39689785-39689807 GCTCCTGGAGCCGGGGTCCTCGG - Intergenic