ID: 1136641548

View in Genome Browser
Species Human (GRCh38)
Location 16:31569416-31569438
Sequence GGCGGCCGCCGCGGCTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641548_1136641552 -5 Left 1136641548 16:31569416-31569438 CCTGGGGAGCCGCGGCGGCCGCC No data
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1136641548_1136641557 2 Left 1136641548 16:31569416-31569438 CCTGGGGAGCCGCGGCGGCCGCC No data
Right 1136641557 16:31569441-31569463 CGCAGGAGCCTGCTGGAGGGTGG 0: 1
1: 0
2: 4
3: 117
4: 807
1136641548_1136641558 5 Left 1136641548 16:31569416-31569438 CCTGGGGAGCCGCGGCGGCCGCC No data
Right 1136641558 16:31569444-31569466 AGGAGCCTGCTGGAGGGTGGTGG 0: 1
1: 3
2: 39
3: 335
4: 2406
1136641548_1136641560 14 Left 1136641548 16:31569416-31569438 CCTGGGGAGCCGCGGCGGCCGCC No data
Right 1136641560 16:31569453-31569475 CTGGAGGGTGGTGGTGATGATGG 0: 1
1: 0
2: 8
3: 127
4: 1259
1136641548_1136641561 17 Left 1136641548 16:31569416-31569438 CCTGGGGAGCCGCGGCGGCCGCC No data
Right 1136641561 16:31569456-31569478 GAGGGTGGTGGTGATGATGGTGG No data
1136641548_1136641554 -2 Left 1136641548 16:31569416-31569438 CCTGGGGAGCCGCGGCGGCCGCC No data
Right 1136641554 16:31569437-31569459 CCACCGCAGGAGCCTGCTGGAGG 0: 1
1: 0
2: 0
3: 23
4: 217
1136641548_1136641555 -1 Left 1136641548 16:31569416-31569438 CCTGGGGAGCCGCGGCGGCCGCC No data
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641548 Original CRISPR GGCGGCCGCCGCGGCTCCCC AGG (reversed) Intergenic