ID: 1136641550

View in Genome Browser
Species Human (GRCh38)
Location 16:31569425-31569447
Sequence TCCTGCGGTGGCGGCCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 260}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641550_1136641560 5 Left 1136641550 16:31569425-31569447 CCGCGGCGGCCGCCACCGCAGGA 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1136641560 16:31569453-31569475 CTGGAGGGTGGTGGTGATGATGG 0: 1
1: 0
2: 8
3: 127
4: 1259
1136641550_1136641561 8 Left 1136641550 16:31569425-31569447 CCGCGGCGGCCGCCACCGCAGGA 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1136641561 16:31569456-31569478 GAGGGTGGTGGTGATGATGGTGG No data
1136641550_1136641557 -7 Left 1136641550 16:31569425-31569447 CCGCGGCGGCCGCCACCGCAGGA 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1136641557 16:31569441-31569463 CGCAGGAGCCTGCTGGAGGGTGG 0: 1
1: 0
2: 4
3: 117
4: 807
1136641550_1136641555 -10 Left 1136641550 16:31569425-31569447 CCGCGGCGGCCGCCACCGCAGGA 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1136641550_1136641558 -4 Left 1136641550 16:31569425-31569447 CCGCGGCGGCCGCCACCGCAGGA 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1136641558 16:31569444-31569466 AGGAGCCTGCTGGAGGGTGGTGG 0: 1
1: 3
2: 39
3: 335
4: 2406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641550 Original CRISPR TCCTGCGGTGGCGGCCGCCG CGG (reversed) Intergenic