ID: 1136641552

View in Genome Browser
Species Human (GRCh38)
Location 16:31569434-31569456
Sequence CCGCCACCGCAGGAGCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641541_1136641552 16 Left 1136641541 16:31569395-31569417 CCCGGCTCTTGGTCGCGGGGTCC 0: 1
1: 1
2: 0
3: 3
4: 86
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1136641537_1136641552 20 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1136641548_1136641552 -5 Left 1136641548 16:31569416-31569438 CCTGGGGAGCCGCGGCGGCCGCC No data
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1136641535_1136641552 26 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1136641539_1136641552 19 Left 1136641539 16:31569392-31569414 CCACCCGGCTCTTGGTCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167
1136641542_1136641552 15 Left 1136641542 16:31569396-31569418 CCGGCTCTTGGTCGCGGGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1136641552 16:31569434-31569456 CCGCCACCGCAGGAGCCTGCTGG 0: 1
1: 0
2: 0
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641552 Original CRISPR CCGCCACCGCAGGAGCCTGC TGG Intergenic