ID: 1136641555

View in Genome Browser
Species Human (GRCh38)
Location 16:31569438-31569460
Sequence CACCGCAGGAGCCTGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 156}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136641537_1136641555 24 Left 1136641537 16:31569391-31569413 CCCACCCGGCTCTTGGTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 29
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1136641548_1136641555 -1 Left 1136641548 16:31569416-31569438 CCTGGGGAGCCGCGGCGGCCGCC No data
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1136641539_1136641555 23 Left 1136641539 16:31569392-31569414 CCACCCGGCTCTTGGTCGCGGGG 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1136641535_1136641555 30 Left 1136641535 16:31569385-31569407 CCGCTGCCCACCCGGCTCTTGGT 0: 1
1: 0
2: 1
3: 18
4: 238
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1136641542_1136641555 19 Left 1136641542 16:31569396-31569418 CCGGCTCTTGGTCGCGGGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1136641550_1136641555 -10 Left 1136641550 16:31569425-31569447 CCGCGGCGGCCGCCACCGCAGGA 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156
1136641541_1136641555 20 Left 1136641541 16:31569395-31569417 CCCGGCTCTTGGTCGCGGGGTCC 0: 1
1: 1
2: 0
3: 3
4: 86
Right 1136641555 16:31569438-31569460 CACCGCAGGAGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 13
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136641555 Original CRISPR CACCGCAGGAGCCTGCTGGA GGG Intergenic