ID: 1136654271

View in Genome Browser
Species Human (GRCh38)
Location 16:31700617-31700639
Sequence CAGGGTACACAGATCAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136654271_1136654280 30 Left 1136654271 16:31700617-31700639 CCCTGCTTGATCTGTGTACCCTG 0: 1
1: 0
2: 0
3: 18
4: 118
Right 1136654280 16:31700670-31700692 GCCCTGTGACCTGCAGGTACTGG 0: 4
1: 23
2: 33
3: 56
4: 258
1136654271_1136654278 24 Left 1136654271 16:31700617-31700639 CCCTGCTTGATCTGTGTACCCTG 0: 1
1: 0
2: 0
3: 18
4: 118
Right 1136654278 16:31700664-31700686 TCCTTTGCCCTGTGACCTGCAGG 0: 1
1: 0
2: 5
3: 113
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136654271 Original CRISPR CAGGGTACACAGATCAAGCA GGG (reversed) Intergenic
901532130 1:9860196-9860218 CAGGCTCCACAGACCAGGCAGGG + Intronic
902834866 1:19040471-19040493 GAGGGAACACAGGTCAGGCAGGG + Intergenic
907331577 1:53675359-53675381 GAGGTCACACAGCTCAAGCAGGG + Intronic
910712560 1:90196657-90196679 CAGGGTGCACTAATCAAGAAAGG - Intergenic
914325020 1:146604558-146604580 CAGGGTACACAGCTCAGGCTTGG + Intergenic
914921019 1:151847579-151847601 CTAGGGACACAGATGAAGCAAGG - Intronic
915254600 1:154616787-154616809 CTGGGTACACAGATCTATCTGGG - Intronic
915978040 1:160403263-160403285 CAGCGTATACAGAGCAAACAAGG - Intronic
918197530 1:182236136-182236158 CTGTGTGCACACATCAAGCAAGG + Intergenic
918708739 1:187701570-187701592 CAGGGTAAACAGATCTACCCTGG - Intergenic
923811872 1:237327209-237327231 CTGGGTACAAAGAGAAAGCATGG + Intronic
1063016765 10:2085990-2086012 CATGGCACACAGATGATGCAAGG - Intergenic
1065685637 10:28281912-28281934 CAGTGTACACCAATTAAGCAAGG + Intronic
1068211067 10:53921539-53921561 AAGGATACACAGCTCAAGCCAGG + Intronic
1068883879 10:62078616-62078638 CAGTGAACACAGACCATGCATGG - Intronic
1069345809 10:67468535-67468557 CAGGGTACAGAGATGTAGCTTGG + Intronic
1070934410 10:80282190-80282212 CAGGGCTCAAAAATCAAGCAAGG + Intronic
1073740238 10:106398562-106398584 CAGGGGACAGAGAGCAATCAGGG - Intergenic
1075791054 10:125084671-125084693 CAGGGGACACAGAACGGGCAAGG - Intronic
1077617214 11:3685381-3685403 CAGTGGACACAGAAAAAGCAGGG + Intronic
1080190283 11:29537238-29537260 AAGGTTACACAGATAAAACATGG + Intergenic
1084271882 11:68033368-68033390 CTGGGGACGCACATCAAGCAGGG - Intronic
1085487828 11:76883129-76883151 CAGGGTACACATTTCAAGAAGGG - Intronic
1088568157 11:111195131-111195153 CAGGGTATACAGGACAGGCAGGG - Intergenic
1090403102 11:126461384-126461406 CGGGGCACACAGTGCAAGCAGGG - Intronic
1091305486 11:134533253-134533275 CAGGGTACACAGGGCCAGCTTGG - Intergenic
1092423450 12:8353703-8353725 CAGAGTAAACAGATCACCCACGG - Intergenic
1094066364 12:26364820-26364842 CAGGGTACACAGAACAAATTGGG - Intronic
1094483072 12:30900387-30900409 CTGGGGACACAGAAAAAGCAAGG - Intergenic
1098018181 12:66128508-66128530 AAGGGTACACAGTTCACTCAGGG - Intronic
1101181623 12:102225248-102225270 CAGGGTACAAAGACAAAACAGGG - Intergenic
1106874366 13:34055487-34055509 CAAGGCACACAGATCACTCAAGG - Intergenic
1118076850 14:62308774-62308796 CAGGTGACACAGAGAAAGCATGG + Intergenic
1119123144 14:72098332-72098354 CAGGGGACAGAGAAAAAGCAAGG - Intronic
1120628847 14:86864176-86864198 CAGAGTACACTGCTCATGCATGG - Intergenic
1121377612 14:93428845-93428867 CAGGTTACACAGATCATGAGAGG + Intronic
1121555137 14:94830699-94830721 CAGGGTACTAAGTTCCAGCAAGG - Intergenic
1122405582 14:101498851-101498873 CAGGGCCCACAGATCTTGCATGG - Intergenic
1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG + Intergenic
1124808537 15:32910492-32910514 CAGGGTCTCCAGATCAACCACGG + Exonic
1128755787 15:70182771-70182793 CAGGGTACACAGGTAGATCAAGG - Intergenic
1130830625 15:87594887-87594909 CAGGGGACACAGCTCATGCAAGG - Intergenic
1132758161 16:1495998-1496020 CAGGGAAAACAGAGCGAGCATGG - Intronic
1134533902 16:15008794-15008816 CAGGGTACACGGCACAAGCAGGG - Exonic
1135196806 16:20401713-20401735 CAGGGTACAGAGCTGAACCATGG + Intronic
1135481069 16:22821039-22821061 CTGGCTACAGAGATGAAGCAGGG - Intronic
1136038642 16:27560603-27560625 CAGGGAACACAGCACAGGCAAGG - Intronic
1136654271 16:31700617-31700639 CAGGGTACACAGATCAAGCAGGG - Intergenic
1139283810 16:65792794-65792816 CAGGGAAGACAGAGCAAGCAAGG + Intergenic
1139758973 16:69168957-69168979 CAGGGTAGACAGTTCAAGGAAGG - Exonic
1139862137 16:70031931-70031953 CAGGGTACACGGCACAAGCAGGG + Intergenic
1140008544 16:71106388-71106410 CAAGGTACACAGCTCAGGCTTGG - Intronic
1144863883 17:18322753-18322775 CACCGCACACAGATCAAGCGGGG + Exonic
1145889125 17:28402622-28402644 CAGGGCACAGAAAACAAGCATGG + Exonic
1146607530 17:34273847-34273869 CAGAGGTCACAGATCAAGCCTGG - Intergenic
1146725007 17:35149313-35149335 CAGGGAACACATTTCAGGCAGGG + Intronic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1147663481 17:42130072-42130094 AAGGCCACACAGATCAAGAAGGG + Intronic
1152143853 17:78555687-78555709 CAGGGTGCCCAGATTAAACATGG + Intronic
1152439384 17:80296308-80296330 CAGGGTATTCAGACCCAGCACGG - Intronic
1152709493 17:81863895-81863917 CAAGGCACACAGACCAGGCAAGG + Intergenic
1154113336 18:11589559-11589581 CAGGCTCCACAGATCAAGGATGG + Intergenic
1158527997 18:58232557-58232579 CCGGTTACACAGATCAATTACGG - Intronic
1164436289 19:28232721-28232743 CAGGGTCCTCAGATCCAGGAAGG + Intergenic
1164483796 19:28637512-28637534 CAGGGAACACAGCTCAATCAAGG - Intergenic
1165760567 19:38319061-38319083 AAGGGTACAATGATCAAGCCTGG - Intergenic
1167326071 19:48826680-48826702 CAGGGTTCACTGGTTAAGCAGGG + Intronic
1167432551 19:49462744-49462766 CAGGGTGCACAGGTGAGGCAGGG + Exonic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926905985 2:17806072-17806094 CAGGGTGCACAGAGCCAGCAGGG + Intergenic
927576433 2:24205474-24205496 CAGGGCAGAAAGAGCAAGCAGGG - Intronic
928174078 2:29022508-29022530 CAGGGCACACACATAAAGCCAGG - Intronic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
939660842 2:144887615-144887637 CAGGCAACACAGGTAAAGCATGG + Intergenic
940272526 2:151907168-151907190 TAGGGAAAACAGAACAAGCAAGG + Intronic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
943979582 2:194531132-194531154 CATGGGAGACAGAACAAGCATGG + Intergenic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
948147439 2:235718477-235718499 GATGGTACACAGAACAAGGAGGG - Intronic
948723124 2:239913714-239913736 CAGTGTTGACAGATCAAACATGG - Intronic
1171172647 20:23029165-23029187 TAGGGTACACTGAAAAAGCATGG + Intergenic
1171822705 20:29868830-29868852 CAGGGCACCCAGACCAAGCCAGG - Intergenic
1172905088 20:38363432-38363454 CAGGGTGCACACATTAAGCTCGG + Intronic
1174082136 20:47978107-47978129 CAGGGCTAACAGATGAAGCATGG - Intergenic
1174134345 20:48368678-48368700 CAGGGCTAACAGATGAAGCATGG + Intergenic
1178995517 21:37395657-37395679 GAGGGGACACAGATAATGCAGGG - Intronic
1181451805 22:23027670-23027692 CAGGGTAAACAGATCTTACATGG - Intergenic
1185082477 22:48717705-48717727 CAGGGACCACAGAGCAGGCATGG + Intronic
950194402 3:10998963-10998985 CAGGGTGCACAGACCAAGTTTGG + Intronic
951045099 3:18028961-18028983 CAGAGCAGACAGATCAGGCAAGG + Intronic
952596125 3:35019754-35019776 AAGGGTACAGAGAGCTAGCAAGG - Intergenic
953135585 3:40178978-40179000 TAGGGTACACAGAAGACGCAGGG - Intronic
953478196 3:43224178-43224200 CTGGGTAGACACATAAAGCATGG - Intergenic
957083174 3:75655806-75655828 CAGGCCGCACAGATCAGGCAGGG - Intergenic
958038048 3:88192845-88192867 CAGGGTGCCCAGATTAAACATGG - Intergenic
962331026 3:134478535-134478557 CAAAGTACACAGATAAAGCATGG - Exonic
962379267 3:134884056-134884078 CAGGGCACACAGCTCTAGCACGG - Intronic
963309506 3:143693442-143693464 CAGTGTACAGAGACCTAGCACGG - Intronic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
969933909 4:10662313-10662335 CAGGGGATTTAGATCAAGCATGG - Intronic
985544042 5:500430-500452 CAGGAAACACACACCAAGCACGG + Intronic
985626298 5:990336-990358 CAGGGGACACAGCTCAAGCCTGG - Intergenic
986220902 5:5767631-5767653 CAGGTCACAGAGATCAAGCAGGG + Intergenic
989487354 5:42007562-42007584 CTGGGTACTCAGATTAATCAAGG - Intergenic
994104847 5:95936077-95936099 CAGGGTACATTGATGAAGTATGG + Intronic
997514518 5:134477514-134477536 AATGGTTCTCAGATCAAGCATGG - Intergenic
997634879 5:135398173-135398195 CAGGGGCCACAGATCACTCAAGG - Intronic
998648299 5:144089229-144089251 CATGGTACTGAGATCAATCAGGG + Intergenic
1005237707 6:23784814-23784836 CAGAGAACACAGAGCACGCAAGG - Intergenic
1008761531 6:54857790-54857812 CAGGGTACAACGATTAAGTATGG + Intronic
1010453609 6:76030218-76030240 CAGCTTACACCCATCAAGCAGGG - Intronic
1014373948 6:120648471-120648493 CAGGATACTTAGATAAAGCATGG + Intergenic
1018294203 6:162328412-162328434 CTGTGTTCACAGAACAAGCAGGG - Intronic
1019558863 7:1645961-1645983 CAGGTTACACAGACCACGCGGGG + Intergenic
1020879729 7:13744881-13744903 GAGGGTACACAGTCTAAGCAAGG - Intergenic
1024278504 7:47698456-47698478 AAGGGCACACAGCTCAAGCAGGG + Intronic
1024535405 7:50426880-50426902 CCAGGTCCACAGATCAAGGAAGG - Intergenic
1026194634 7:68162580-68162602 CACTGTACACTGATCAAGCCTGG + Intergenic
1032334017 7:131007796-131007818 CAGGGACCAAAGTTCAAGCAGGG + Intergenic
1036705470 8:11043080-11043102 CAGAGTACTCAGAACACGCAGGG + Intronic
1037425835 8:18753628-18753650 CAGGGAACAGAGTTCAAGAATGG + Intronic
1041182099 8:55259573-55259595 CAGGGTCCCCACATCAAGCGAGG - Intronic
1041977388 8:63815748-63815770 CAGGGACCACAGAGCCAGCATGG - Intergenic
1049653399 8:143787157-143787179 CAGGGTATTCAAAGCAAGCAGGG + Intergenic
1051995814 9:23216370-23216392 CAGGTTCCAGAGATCATGCATGG - Intergenic
1054826744 9:69581027-69581049 CAGGGGACACAGATCAAAGATGG + Intronic
1056584968 9:87921832-87921854 CTGAGTACACAGCTCAAGGAAGG - Intergenic
1057093162 9:92278942-92278964 AAGGGTACACAGATGCATCAAGG - Intronic
1059962120 9:119575775-119575797 CAGGGAACTGAGATCAAACATGG + Intergenic
1060664892 9:125427044-125427066 CAGGGCACACAGCTAAGGCACGG - Intergenic
1062426877 9:136510212-136510234 CAGGCTTCACAGACCGAGCAGGG + Intronic
1186064987 X:5753628-5753650 AAGGGTACAAAGATTAAGCTTGG + Intergenic
1190299197 X:49046571-49046593 CAGGGTAGGCATATCATGCAGGG - Intergenic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1196455987 X:115892021-115892043 CAGGGAACACAAACCAAGGAAGG + Intergenic
1199552504 X:149074872-149074894 TGGGGTACTCAGATCAACCATGG - Intergenic