ID: 1136655958

View in Genome Browser
Species Human (GRCh38)
Location 16:31709397-31709419
Sequence CTATATCCCTGGGTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1136655949_1136655958 -10 Left 1136655949 16:31709384-31709406 CCTGCCCCTCCAGCTATATCCCT 0: 1
1: 0
2: 0
3: 20
4: 289
Right 1136655958 16:31709397-31709419 CTATATCCCTGGGTGGAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 118
1136655948_1136655958 -3 Left 1136655948 16:31709377-31709399 CCAGCATCCTGCCCCTCCAGCTA 0: 1
1: 1
2: 3
3: 27
4: 399
Right 1136655958 16:31709397-31709419 CTATATCCCTGGGTGGAGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1136655958 Original CRISPR CTATATCCCTGGGTGGAGCT GGG Intergenic
900115792 1:1027356-1027378 CTATGTCCCTGGGTTCAGCCCGG + Intronic
901700708 1:11043652-11043674 CTGCATCCCTGGGTTGGGCTGGG + Intronic
902304557 1:15526251-15526273 GTACATTCTTGGGTGGAGCTCGG + Intronic
905064422 1:35168000-35168022 CTATTTCCCTGAGTGTATCTTGG - Intergenic
906196520 1:43933695-43933717 CCAGATCCCGGGGTGGGGCTGGG - Exonic
915496584 1:156286245-156286267 CAGGATCCCTGGGTGGAGTTGGG - Exonic
921080996 1:211738320-211738342 CTACAGCCCAGGGTGGAGCGGGG - Intergenic
924279183 1:242418960-242418982 TTAGTTCCCTGGCTGGAGCTAGG + Intronic
1063199790 10:3776859-3776881 CTGTTTGCCTGGGTGGGGCTGGG - Exonic
1070512035 10:77170414-77170436 CTGTATCCCTGGGAGAAGGTTGG + Intronic
1070788396 10:79175507-79175529 CTCTATCGCTGGGTTGGGCTGGG + Intronic
1072909507 10:99487309-99487331 TATTATCCCTGGGGGGAGCTGGG + Intergenic
1072927618 10:99630163-99630185 CTATACCCCTGGCTGGAGTGCGG + Intergenic
1077150534 11:1071149-1071171 CTGTGTCCCTGTGTGGGGCTGGG + Intergenic
1077317046 11:1924235-1924257 CTGTAACCCTGGGTGGAGCCTGG + Intronic
1080855119 11:36105373-36105395 CTATATCCCTGCATGCAGCCAGG - Intronic
1084540908 11:69786525-69786547 CCAGATCCCTGCCTGGAGCTGGG + Intergenic
1086982855 11:93217816-93217838 CAAAATCCCTGGGTGGGGGTGGG + Intergenic
1087388403 11:97503742-97503764 CTATATCTCTGGCTGGAGCTAGG - Intergenic
1088906368 11:114158203-114158225 CTAGACCCCTGTGTGGTGCTGGG + Intronic
1089127434 11:116186614-116186636 CCATATGCCTGGGTGATGCTGGG - Intergenic
1092900829 12:13057959-13057981 CTATATGAGTGGGTGGAGCTGGG + Intronic
1093054910 12:14546476-14546498 CTGGAACTCTGGGTGGAGCTAGG - Intronic
1096193712 12:49635636-49635658 CTATAGTCCTGGGTGTAGCAGGG + Intronic
1099898516 12:88679074-88679096 CTGTTTCCCTGGGTGTAGGTGGG - Intergenic
1102003758 12:109575357-109575379 CTATATACCTTGGTAGAGCTTGG + Intronic
1104838129 12:131805361-131805383 CTATCTCCCTGGGTGCCTCTGGG + Intergenic
1106004371 13:25755273-25755295 CTTTGTCCCTGGGTGAAGCTGGG - Intronic
1110789800 13:79575354-79575376 CTTTGTTCCTGGGTGGATCTAGG + Intergenic
1116257813 14:42579865-42579887 CAATATCCCAGGGTGTATCTGGG + Intergenic
1116560948 14:46377498-46377520 CTAGCTCCCTGGGTGGAGGAAGG - Intergenic
1118663926 14:68046011-68046033 CAATTTCCCTAGGTGGAGCCAGG - Intronic
1119674901 14:76546387-76546409 CTCTTTACCTGGCTGGAGCTTGG + Intergenic
1119886203 14:78145031-78145053 CTGTATCCCTTGGTGGTGGTGGG + Intergenic
1128246213 15:66134510-66134532 CCATAGCCCTGGGAGGAGGTGGG - Intronic
1128975151 15:72146788-72146810 CTAGATTTCTGGCTGGAGCTGGG - Intergenic
1130679370 15:85982971-85982993 CTATATCCTTGTCTGGAGTTTGG - Intergenic
1131733605 15:95308585-95308607 TTATTTCCCTGTGGGGAGCTGGG + Intergenic
1132208553 15:100003249-100003271 CTAGAACCCCAGGTGGAGCTGGG - Intronic
1132587073 16:710242-710264 CCCCCTCCCTGGGTGGAGCTGGG - Intronic
1132766625 16:1537589-1537611 CTCTTTCCCTGTGAGGAGCTCGG + Intronic
1136655958 16:31709397-31709419 CTATATCCCTGGGTGGAGCTGGG + Intergenic
1138567802 16:57846203-57846225 CCCTCTCCCTGGGTGGGGCTGGG + Intronic
1141162670 16:81639641-81639663 CTTTATCCATTGGTGGACCTGGG + Intronic
1145782100 17:27570142-27570164 CTCTATCCCTGGGCCCAGCTAGG - Intronic
1147595241 17:41712518-41712540 CTTTATCCCAGGATGGAACTAGG + Intronic
1150636514 17:66916922-66916944 CTATATCCATGGGTGCCTCTGGG - Intergenic
1151455321 17:74222344-74222366 CTTGAACCCTAGGTGGAGCTTGG + Intronic
1151879326 17:76885625-76885647 CTATTTCCCAGGAGGGAGCTGGG - Intronic
1152204843 17:78969110-78969132 CCATAGCCCTGTGTGGGGCTGGG - Intergenic
1152816333 17:82410254-82410276 CAGTAACCCTGCGTGGAGCTAGG + Intronic
1154245374 18:12692277-12692299 CTATCGCCCAGGGTGGAGCACGG - Intronic
1157555306 18:48609686-48609708 CCATATCCCTGGCTGGAGTCAGG - Intronic
1158028437 18:52932299-52932321 CTTTCTTCCTGTGTGGAGCTGGG - Intronic
1161735297 19:5988568-5988590 CTAGGTCCCGGGGAGGAGCTGGG - Intergenic
1162197991 19:9000440-9000462 CCACATACCTGAGTGGAGCTGGG - Intergenic
1162552090 19:11363764-11363786 CTCTCTCCCTGGGAGGACCTGGG + Exonic
1163786926 19:19279564-19279586 CTAAATCCCAGTGTGGAGCACGG + Intronic
1164212174 19:23108784-23108806 CTATTGCCCTGGCTGGAGCACGG + Intronic
1166010084 19:39935285-39935307 CTGGGTCCCTGGGTGGAGGTGGG + Intergenic
1168139168 19:54373677-54373699 CTGTCTCCCTGGTTCGAGCTGGG - Intergenic
1168400605 19:56084207-56084229 CTGTATACCCGGGTGGGGCTGGG - Intergenic
927397453 2:22670191-22670213 GTATGACCCTGGGTAGAGCTTGG + Intergenic
930750256 2:54927645-54927667 CTTTATCCCCGGGTGGAGGGTGG - Intronic
930901440 2:56511708-56511730 CTCTATGCCTGGTTGGAGATGGG - Intergenic
935365855 2:102290189-102290211 CTAGATCCCTGAGGGGAGCGGGG + Intergenic
937032926 2:118755773-118755795 CAAAATCCCTGGCTGGGGCTTGG + Intergenic
940852573 2:158702587-158702609 CTAAATCCATGGGTGGACTTTGG - Intergenic
941651469 2:168097046-168097068 CTTTAACCCTGGGTTGTGCTAGG - Intronic
941948661 2:171129796-171129818 CTATATCCCAGGCTGGAGTGCGG - Intronic
944210510 2:197202038-197202060 TTCTATCCCTGGGTGGAGGAGGG - Intronic
1170603645 20:17860074-17860096 CTGTATCCCTGGTTGGAGCCTGG + Intergenic
1174427750 20:50444806-50444828 CTGTAGCCCAGGCTGGAGCTCGG - Intergenic
1175092786 20:56518737-56518759 CTACAGCCCTGGGAGGAGCCAGG + Exonic
1179791811 21:43760070-43760092 CTGTAGCCCTGGGCAGAGCTGGG + Exonic
1180941791 22:19664187-19664209 CTATATCCCGCGGTGGAGCGTGG - Intergenic
1181977153 22:26738164-26738186 CTATAGGTCTGGGTGGAGCCTGG - Intergenic
1184371257 22:44083521-44083543 CTCTATCCCTGGGTGCAGTTCGG - Intronic
953169969 3:40498064-40498086 CCAGATCCCTGGGTGCTGCTTGG + Intergenic
953577937 3:44128179-44128201 CTCTAGGCCTGGGTGGTGCTAGG + Intergenic
960525193 3:118701754-118701776 CTATGTCAATGGGTGGTGCTAGG - Intergenic
960931395 3:122854533-122854555 TTATATGCATGGGTGCAGCTGGG + Intronic
964268934 3:154933888-154933910 CTTTATCCCTGGGAGGAAGTAGG - Intergenic
969281788 4:6175655-6175677 CCATCTGCCTGGGTGGAGCTGGG - Intronic
969610720 4:8226403-8226425 CCATTTCCCTGCATGGAGCTGGG + Intronic
970120231 4:12745607-12745629 CTATTTTACTGGGTGGAGCAGGG - Intergenic
971166596 4:24190173-24190195 TTGTATCCATGGGTGGAGTTGGG - Intergenic
976419562 4:84825064-84825086 CCATAACCCTGGGAGGTGCTAGG + Intronic
976709975 4:88059702-88059724 CTATATCTCTGGGAGGTGCAAGG - Intronic
987306577 5:16643172-16643194 AGGTCTCCCTGGGTGGAGCTGGG - Intergenic
987371946 5:17201575-17201597 CAATATCCCAGGGTGTAGTTAGG + Intronic
988595610 5:32587438-32587460 CTATGTCTCTGGGGGGACCTGGG + Intronic
991697782 5:69289076-69289098 CTGCAACCCTGTGTGGAGCTTGG - Intronic
992258477 5:74946164-74946186 CTATCTCCCTGGGTCAAGCCGGG + Intergenic
993599441 5:89902612-89902634 CTGTAGCCCAGGCTGGAGCTAGG + Intergenic
994301990 5:98157891-98157913 CTATATCACTGTGTGGACCCAGG + Intergenic
997058350 5:130471209-130471231 CTATATGCATGTGTGGAGGTAGG - Intergenic
999004663 5:147962474-147962496 CCCTAGCCCTGGATGGAGCTGGG + Intergenic
999024108 5:148206082-148206104 CTTTCTGCCTGGGTGGTGCTTGG + Intronic
1001266253 5:170276587-170276609 CCAAATCCCAGGATGGAGCTGGG + Intronic
1002351360 5:178585699-178585721 CTACAGCCCTGGATGGCGCTGGG + Intronic
1004853065 6:19720100-19720122 CTATATCCCAGGCTGGAGACAGG + Intergenic
1007430750 6:41775384-41775406 CCCTATCCCAGGGTGGAGCAGGG + Intronic
1013316829 6:108951360-108951382 CTATTTCCCGGGGTGGAGTCAGG + Intronic
1014437706 6:121438509-121438531 CTACATCCAGGGGTGTAGCTTGG + Intronic
1015917290 6:138230122-138230144 CAATACGCCTGGGTGGAGCAGGG - Intronic
1019502331 7:1370411-1370433 CTCTCTCCCTGGGAGGAGGTGGG - Intergenic
1023320176 7:38988308-38988330 CTATTTATCTGGGTGGAGCTTGG + Intronic
1024055612 7:45658296-45658318 CTAGATGGCTGTGTGGAGCTTGG - Intronic
1027810100 7:82885376-82885398 CTGTATCCCTTTCTGGAGCTTGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1037814740 8:22106159-22106181 CTATCACCCAGGCTGGAGCTCGG + Intergenic
1038123902 8:24649579-24649601 CTTTATATCTGGGTGTAGCTTGG + Intergenic
1040614139 8:49018063-49018085 CTTTGTCCCTTGGTGGAGGTGGG + Intergenic
1042218299 8:66449194-66449216 CTATGTCCCTGGCTGTGGCTGGG - Intronic
1047338902 8:123961227-123961249 CTATCGCCCAGGCTGGAGCTGGG - Intronic
1048397941 8:134032672-134032694 CTTTGTCCCTGGGGGGAACTGGG - Intergenic
1049440311 8:142606563-142606585 CCATCTCTCTGGGCGGAGCTGGG - Intergenic
1049679561 8:143911755-143911777 TTATTTCCTTGGCTGGAGCTGGG - Intergenic
1058504974 9:105657623-105657645 CTATATTCCTGGGTGGATGGGGG - Intergenic
1185643077 X:1599049-1599071 CTTTATCCCAAGGTGGACCTCGG - Intronic
1187306836 X:18102791-18102813 CTCTATCCCTGGGGTGTGCTGGG - Intergenic
1195904484 X:109830169-109830191 CAATATCCCTGGGCGGGGGTGGG + Intergenic
1196707173 X:118727079-118727101 CTACTTCACTGGGTGGAGTTGGG - Intergenic
1197663179 X:129195533-129195555 AAATATCTCTGGGTGGGGCTAGG + Intergenic
1198029549 X:132741767-132741789 TTGCATCCCTGGGTGGAACTTGG - Intronic
1200695222 Y:6352635-6352657 CTATACCTCTGGGCTGAGCTGGG - Intergenic
1201040055 Y:9822075-9822097 CTATACCTCTGGGCTGAGCTGGG + Intergenic
1201739045 Y:17304010-17304032 CTGTATCCCTGGCTGAAGCAGGG - Intergenic